The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s).
A61K 39/39 - Préparations médicinales contenant des antigènes ou des anticorps caractérisées par les additifs immunostimulants, p. ex. par les adjuvants chimiques
A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps
C07K 14/47 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains provenant de vertébrés provenant de mammifères
C07K 14/005 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant de virus
C07K 14/31 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant de bactéries provenant de Micrococcaceae (F) provenant de Staphylococcus (G)
C12N 7/00 - Virus, p. ex. bactériophagesCompositions les contenantLeur préparation ou purification
The present invention relates to new pneumococcal vaccines. The invention also relates to vaccination of subjects, in particular immunocompromised subjects, against pneumoccocal infections using said novel pneumococcal vaccines.
Described are vaccines having one or more antigens cholesterol and CpG. Aspects of the invention relate to the use of the vaccines of the invention for the treatment and/or prevention of human and animal disorders.
A61K 39/39 - Préparations médicinales contenant des antigènes ou des anticorps caractérisées par les additifs immunostimulants, p. ex. par les adjuvants chimiques
A61K 39/10 - BrucellaBordetella, p. ex. Bordetella pertussis
A61K 39/155 - Paramyxoviridae, p. ex. virus de para-influenza
The present invention relates to new pneumococcal vaccines. The invention also relates to vaccination of subjects, in particular immunocompromised subjects, against pneumoccocal infections using said novel pneumococcal vaccines.
A61K 39/39 - Préparations médicinales contenant des antigènes ou des anticorps caractérisées par les additifs immunostimulants, p. ex. par les adjuvants chimiques
The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s).
The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s).
A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
A61K 45/00 - Préparations médicinales contenant des ingrédients actifs non prévus dans les groupes
A61K 47/00 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif
C07H 21/04 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le désoxyribosyle comme radical saccharide
C07H 21/00 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques
7.
TRIAZOLE COMPOUNDS AS TOLL-LIKE RECEPTOR (TLR) AGONISTS
Certain triazole compounds are disclosed as Toll-like receptor (TLR) agonists. The compounds of the invention and pharmaceutical compositions including the compounds of the invention are useful for stimulating TLR signaling, specifically including signaling by TLR7 and TLR8. The compounds and pharmaceutical compositions of the invention are also useful in methods for enhancing an immune response, for treating cancer, infection, allergy, and asthma, and for vaccinating a subject. The compounds and pharmaceutical compositions can be used alone, in combination with each other, in combination with an antigen, and in combination with additional therapeutic agents and modalities.
A61P 25/00 - Médicaments pour le traitement des troubles du système nerveux
A61K 39/39 - Préparations médicinales contenant des antigènes ou des anticorps caractérisées par les additifs immunostimulants, p. ex. par les adjuvants chimiques
A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
A61P 17/02 - Médicaments pour le traitement des troubles dermatologiques pour traiter les blessures, les ulcères, les brûlures, les cicatrices, les cheloïdes, ou similaires
8.
PYRIMIDINE COMPOUNDS AS TOLL-LIKE RECEPTOR (TLR) AGONISTS
Certain pyrimidine compounds are disclosed as Toll-like receptor (TLR) agonists. The compounds of the invention and pharmaceutical compositions including the compounds of the invention are useful for stimulating TLR signaling, specifically including signaling by TLR7, TLR8, and TLR9. The compounds and pharmaceutical compositions of the invention are also useful in methods for enhancing an immune response, for treating cancer, infection, allergy, and asthma, and for vaccinating a subject. The compounds and pharmaceutical compositions can be used alone, in combination with each other, in combination with an antigen, and in combination with additional therapeutic agents and modalities.
A61K 39/39 - Préparations médicinales contenant des antigènes ou des anticorps caractérisées par les additifs immunostimulants, p. ex. par les adjuvants chimiques
A61P 11/04 - Médicaments pour le traitement des troubles du système respiratoire des maux de gorge
A61K 31/506 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime non condensées et contenant d'autres hétérocycles
A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
A61P 17/02 - Médicaments pour le traitement des troubles dermatologiques pour traiter les blessures, les ulcères, les brûlures, les cicatrices, les cheloïdes, ou similaires
9.
COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY
lmmunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and./n vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5' TCGTCGTTTTCGGCGCGCGCCGT 3' (SEQ ID NO: 1), in which each C is unmethylated and 3' refers to the 31 end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
Compound CPG 52364 having formula (I) and pharmaceutically acceptable salts thereof are inhibitors of signaling by Toll-like receptors TLR7, TLR8, and TLR9, and they are useful in treatment of unwanted Immune activity. Pharmaceutical composition including CPG 52364 or a pharmaceutically acceptable salt thereof is provided and can be used to treat conditions including autoimmune disease, transplant rejection, graft- versus-host disease, allergy, asthma, sepsis, and other inflammatory conditions.
A61P 37/00 - Médicaments pour le traitement des troubles immunologiques ou allergiques
A61K 31/517 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime condensées en ortho ou en péri avec des systèmes carbocycliques, p. ex. quinazoline, périmidine
11.
CLASS A OLIGONUCLEOTIDES WITH IMMUNOSTIMULATORY POTENCY
A61K 39/39 - Préparations médicinales contenant des antigènes ou des anticorps caractérisées par les additifs immunostimulants, p. ex. par les adjuvants chimiques
12.
PEPTIDE-BASED VACCINE COMPOSITIONS TO ENDOGENOUS CHOLESTERYL ESTER TRANSFER PROTEIN (CETP)
Improved vaccine compositions and methods of use thereof are described that elicit production of antibodies in an individual to the individual's own endogenous cholesteryl ester transfer protein (CETP).
Substituted 4H-imidazo[4,5, 1-ij][1,6]naphthyridine-9-amines of the Formula I : pharmaceutical compositions containing the compounds, intermediates, methods of making the compounds, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/437 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à cinq chaînons ayant l'azote comme hétéro-atome du cycle, p. ex. indolizine, bêta-carboline
The invention relates to methods and products for the treatment of viral infection using a combination of anti-viral agents and TLR ligands. The invention also relates to screening assays, associated products, kits, and in vitro methods.
The present invention provides methods of killing fungal cells using immune response modifier compounds. In one aspect, the method generally includes contacting an immune response modifier (IRM) compound with a fungicidal effector cell, thereby activating the fungicidal effector cell, and allowing the activated fungicidal effector cell to kill fungal cells. In another aspect, the method generally includes contacting a fungicidal IRM compound with fungal cells in an amount effective to kill fungal cells.
A61K 31/00 - Préparations médicinales contenant des ingrédients actifs organiques
A61K 31/4745 - QuinoléinesIsoquinoléines condensées en ortho ou en péri avec des systèmes hétérocycliques condensées avec des systèmes cycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. phénanthrolines
The invention relates to modified oligoribonucleotides with immunomodulatory activity. The invention encompasses treatment of autoimmune and infectious diseases using the oligonucleotides of the invention.
Small molecule compounds and compositions containing said compounds useful for inhibiting signaling by certain Toll-like receptors (TLRs), particularly TLR9, are provided. The compounds and compositions can be used to inhibit immune responses, including unwanted immune responses in particular. Compounds, compositions, and methods are provided to treat a variety of conditions involving unwanted immune responses, including for example autoimmune disease, inflammation, transplant rejection, and sepsis.
C07D 401/14 - Composés hétérocycliques contenant plusieurs hétérocycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle, au moins un cycle étant un cycle à six chaînons avec un unique atome d'azote contenant au moins trois hétérocycles
18.
SUBSTITUTED CHIRAL FUSED( 1,2) IMIDAZO (4,5-C) RING COMPOUNDS AND METHODS
Substituted fused [l,2]imidazo[4,5-c] ring compounds (e.g., imidazo[4,5- c]quinolines, 6,7,8,9-tetrahydroimidazo[4,5-c]quinoIines, imidazo[4,5-c]naphthyridines, 6,7,8,9-tetrahydroimidazo[4,5-c]naphthyridines, and imidazo[4,5-c]pyridines ) with a -CHC-R2)- group in the fused ring at the 2-position of the imidazo ring and a.-CH(-Ri)- group in the fused ring at the 1 -position of the imidazo ring, pharmaceutical compositions containing the compounds, intermediates, methods of making the compounds, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/5365 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec au moins un azote et au moins un oxygène comme hétéro-atomes d'un cycle, p. ex. 1,2-oxazines condensées en ortho ou en péri avec des systèmes hétérocycliques
6,7,8,9-Tetrahydro-1H-imidazo[4,5-c]naphthyridines with a substituent at the 6-, 7-, 8-, or 9-position nitrogen atom, pharmaceutical compositions containing these compounds, methods of making the compounds, intermediates, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
1H-Imidazo[4,5-c]naphthyridin-4-amines with a hydroxy, alkoxy, hydroxyalkoxy, or alkoxyalkoxy substituent at the 2-position, pharmaceutical compositions containing these compounds, methods of making the compounds, intermediates, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/437 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à cinq chaînons ayant l'azote comme hétéro-atome du cycle, p. ex. indolizine, bêta-carboline
A61K 31/4375 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à six chaînons ayant l'azote comme hétéro-atome du cycle, p. ex. quinolizines, naphtyridines, berbérine, vincamine
[1,2]Imidazo[4,5-c] ring compounds (e.g., imidazo[4,5-c]quinolines, imidazo[4,5-c]naphthyridines, and imidazo[4,5-c]pyridines) substituted with a fused ring containing an oxygen and/or nitrogen atom attached at the 1- and/or 2-position, pharmaceutical compositions containing the compounds, intermediates, methods of making the compounds, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/4738 - QuinoléinesIsoquinoléines condensées en ortho ou en péri avec des systèmes hétérocycliques
A61K 31/5365 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec au moins un azote et au moins un oxygène comme hétéro-atomes d'un cycle, p. ex. 1,2-oxazines condensées en ortho ou en péri avec des systèmes hétérocycliques
C07D 471/12 - Composés hétérocycliques contenant des atomes d'azote comme uniques hétéro-atomes du système condensé, au moins un cycle étant un cycle à six chaînons avec un atome d'azote, non prévus dans les groupes dans lesquels le système condensé contient trois hétérocycles
C07D 498/12 - Composés hétérocycliques contenant dans le système condensé au moins un hétérocycle comportant des atomes d'azote et d'oxygène comme uniques hétéro-atomes du cycle dans lesquels le système condensé contient trois hétérocycles
22.
COMPOSITIONS AND METHODS FOR OLIGONUCLEOTIDE FORMULATIONS
The present invention relates generally to imrnunostimulatory nucleic acids, compositions thereof and methods of using the imrnunostimulatory nucleic acids. In particular the invention relates to palindrome-containing imrnunostimulatory nucleic acids and the use of these nucleic acids in treating disease.
Methods for preparing compounds of the Formulas IV and I are disclosed. The methods include combining a compound of the Formula II: with a benzylamine of the Formula III: in the presence of an acid to provide a 1H-imidazo[4,5-c]pyridine compound of the Formula IV.
C07D 471/02 - Composés hétérocycliques contenant des atomes d'azote comme uniques hétéro-atomes du système condensé, au moins un cycle étant un cycle à six chaînons avec un atome d'azote, non prévus dans les groupes dans lesquels le système condensé contient deux hétérocycles
C07D 491/02 - Composés hétérocycliques contenant dans le système cyclique condensé, à la fois un ou plusieurs cycles comportant des atomes d'oxygène comme uniques hétéro-atomes du cycle, et un ou plusieurs cycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle, non prévus dans les groupes , , ou dans lesquels le système condensé contient deux hétérocycles
C07D 498/02 - Composés hétérocycliques contenant dans le système condensé au moins un hétérocycle comportant des atomes d'azote et d'oxygène comme uniques hétéro-atomes du cycle dans lesquels le système condensé contient deux hétérocycles
C07D 513/02 - Composés hétérocycliques contenant dans le système condensé au moins un hétérocycle comportant des atomes d'azote et de soufre comme uniques hétéro-atomes du cycle, non prévus dans les groupes , ou dans lesquels le système condensé contient deux hétérocycles
C07D 515/02 - Composés hétérocycliques contenant dans le système condensé au moins un hétérocycle comportant des atomes d'azote, d'oxygène et de soufre comme uniques hétéro-atomes du cycle, non prévus dans les groupes , ou dans lesquels le système condensé contient deux hétérocycles
The present invention provides a method of treating Hodgkin's lymphoma. Generally, the method includes administering to a patient with Hodgkin's lymphoma an amount of a TLR agonist compound effective to ameliorate at least one symptom or clinical sign of Hodgkin's lymphoma.
A61K 31/4738 - QuinoléinesIsoquinoléines condensées en ortho ou en péri avec des systèmes hétérocycliques
A61K 31/4745 - QuinoléinesIsoquinoléines condensées en ortho ou en péri avec des systèmes hétérocycliques condensées avec des systèmes cycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. phénanthrolines
A61K 31/4375 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à six chaînons ayant l'azote comme hétéro-atome du cycle, p. ex. quinolizines, naphtyridines, berbérine, vincamine
The present invention provides a method for treating acute lymphoblastic leukemia. Generally, the method includes administering to a patient with ALL an amount of a TLR agonist compound effective to decrease the percentage of leukemic cells in the patient's peripheral blood or bone marrow.
Imidazo ring compounds, (e.g., imidazo⏧4,5-c]quinoline, 6,7,8,9-tetrahydro imidazo⏧4,5-c]quinoline, imidazo⏧4,5-c]naphthyridine, 6,7,8,9-tetrahydro imidazo⏧4,5-c]naphthyridine and imidazo⏧4,5-c]pyridine compounds) having a pyrazoloalkyl substituent at the 1-position, pharmaceutical compositions containing the compounds, intermediates, and methods of making and methods of use of these compounds as immunomodulators, for modulating cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed.
C07D 231/00 - Composés hétérocycliques contenant des cycles diazole-1, 2 ou diazole-1, 2 hydrogéné
C07D 231/02 - Composés hétérocycliques contenant des cycles diazole-1, 2 ou diazole-1, 2 hydrogéné non condensés avec d'autres cycles
C07D 471/22 - Composés hétérocycliques contenant des atomes d'azote comme uniques hétéro-atomes du système condensé, au moins un cycle étant un cycle à six chaînons avec un atome d'azote, non prévus dans les groupes dans lesquels le système condensé contient au moins quatre hétérocycles
A61K 31/4745 - QuinoléinesIsoquinoléines condensées en ortho ou en péri avec des systèmes hétérocycliques condensées avec des systèmes cycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. phénanthrolines
A61K 31/4738 - QuinoléinesIsoquinoléines condensées en ortho ou en péri avec des systèmes hétérocycliques
The present invention provides a method of treating Non-Hodgkin's lymphoma. Generally, the method includes administering to a patient with Non-Hodgkin's lymphoma an amount of a TLR agonist compound effective to ameliorate at least one symptom or clinical sign of Non-Hodgkin's lymphoma.
The present invention provides a method of treating acute myeloid leukemia. Generally, the method includes administering to a patient with AML an amount of a TLR agonist compound effective to decrease the percentage of leukemic cells in the patient's peripheral blood or bone marrow.
Certain 1H-imidazo[4,5-c]quinolines, 6,7,8,9-tetrahydro-1H-imidazo[4,5-c]quinolines, 1H-imidazo[4,5-c][1,5]naphthyridines, 6,7,8,9-tetrahydro-1H-imidazo[4,5-c][1,5]naphthyridines, and 1H-imidazo[4,5-c]pyridines substituted at the 1- and 2-positions, pharmaceutical compositions containing these compounds, methods of making the compounds, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/437 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à cinq chaînons ayant l'azote comme hétéro-atome du cycle, p. ex. indolizine, bêta-carboline
The present invention provides a method of activation murine TLR8. Generally, the method includes contacting a cell expressing the murine TLR8 with a first IRM compound that comprises a TLR8 agonist, and contacting the cell expressing the murine TLR8 with a second IRM compound, wherein the second IRM compound comprises an oligonucleotide sequence comprising at least seven bases in length wherein at least one base is a thymine or a uracil.
The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immnostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8).
C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
A61K 9/127 - Vecteurs à bicouches synthétiques, p. ex. liposomes ou liposomes comportant du cholestérol en tant qu’unique agent tensioactif non phosphatidylique
A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
C07H 21/02 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le ribosyle comme radical saccharide
C07H 21/04 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le désoxyribosyle comme radical saccharide
The present invention relates to new pneumococcal vaccines. The invention also relates to vaccination of subjects, in particular immunocompromised subjects, against pneumoccocal infections using said novel pneumococcal vaccines.
A61K 39/39 - Préparations médicinales contenant des antigènes ou des anticorps caractérisées par les additifs immunostimulants, p. ex. par les adjuvants chimiques
The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s).