The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s).
A61K 39/39 - Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
A61K 39/00 - Medicinal preparations containing antigens or antibodies
C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
C07K 14/005 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from viruses
C07K 14/31 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
C12N 7/00 - Viruses, e.g. bacteriophagesCompositions thereofPreparation or purification thereof
The present invention relates to new pneumococcal vaccines. The invention also relates to vaccination of subjects, in particular immunocompromised subjects, against pneumoccocal infections using said novel pneumococcal vaccines.
Described are vaccines having one or more antigens cholesterol and CpG. Aspects of the invention relate to the use of the vaccines of the invention for the treatment and/or prevention of human and animal disorders.
The present invention relates to new pneumococcal vaccines. The invention also relates to vaccination of subjects, in particular immunocompromised subjects, against pneumoccocal infections using said novel pneumococcal vaccines.
The present invention relates to new pneumococcal vaccines. The invention also relates to vaccination of subjects, in particular immunocompromised subjects, against pneumoccocal infections using said novel pneumococcal vaccines.
The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s).
The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s).
The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s).
A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
A61K 45/00 - Medicinal preparations containing active ingredients not provided for in groups
A61K 47/00 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient
C07H 21/04 - Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
C07H 21/00 - Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
9.
TRIAZOLE COMPOUNDS AS TOLL-LIKE RECEPTOR (TLR) AGONISTS
Certain triazole compounds are disclosed as Toll-like receptor (TLR) agonists. The compounds of the invention and pharmaceutical compositions including the compounds of the invention are useful for stimulating TLR signaling, specifically including signaling by TLR7 and TLR8. The compounds and pharmaceutical compositions of the invention are also useful in methods for enhancing an immune response, for treating cancer, infection, allergy, and asthma, and for vaccinating a subject. The compounds and pharmaceutical compositions can be used alone, in combination with each other, in combination with an antigen, and in combination with additional therapeutic agents and modalities.
Certain pyrimidine compounds are disclosed as Toll-like receptor (TLR) agonists. The compounds of the invention and pharmaceutical compositions including the compounds of the invention are useful for stimulating TLR signaling, specifically including signaling by TLR7, TLR8, and TLR9. The compounds and pharmaceutical compositions of the invention are also useful in methods for enhancing an immune response, for treating cancer, infection, allergy, and asthma, and for vaccinating a subject. The compounds and pharmaceutical compositions can be used alone, in combination with each other, in combination with an antigen, and in combination with additional therapeutic agents and modalities.
lmmunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and./n vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5' TCGTCGTTTTCGGCGCGCGCCGT 3' (SEQ ID NO: 1), in which each C is unmethylated and 3' refers to the 31 end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
Compound CPG 52364 having formula (I) and pharmaceutically acceptable salts thereof are inhibitors of signaling by Toll-like receptors TLR7, TLR8, and TLR9, and they are useful in treatment of unwanted Immune activity. Pharmaceutical composition including CPG 52364 or a pharmaceutically acceptable salt thereof is provided and can be used to treat conditions including autoimmune disease, transplant rejection, graft- versus-host disease, allergy, asthma, sepsis, and other inflammatory conditions.
A61P 37/00 - Drugs for immunological or allergic disorders
A61K 31/517 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
13.
CLASS A OLIGONUCLEOTIDES WITH IMMUNOSTIMULATORY POTENCY
Improved vaccine compositions and methods of use thereof are described that elicit production of antibodies in an individual to the individual's own endogenous cholesteryl ester transfer protein (CETP).
Substituted 4H-imidazo[4,5, 1-ij][1,6]naphthyridine-9-amines of the Formula I : pharmaceutical compositions containing the compounds, intermediates, methods of making the compounds, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/437 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
A61P 31/00 - Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
The invention relates to methods and products for the treatment of viral infection using a combination of anti-viral agents and TLR ligands. The invention also relates to screening assays, associated products, kits, and in vitro methods.
The present invention provides methods of killing fungal cells using immune response modifier compounds. In one aspect, the method generally includes contacting an immune response modifier (IRM) compound with a fungicidal effector cell, thereby activating the fungicidal effector cell, and allowing the activated fungicidal effector cell to kill fungal cells. In another aspect, the method generally includes contacting a fungicidal IRM compound with fungal cells in an amount effective to kill fungal cells.
A61K 31/00 - Medicinal preparations containing organic active ingredients
A61K 31/4745 - QuinolinesIsoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenanthrolines
The invention relates to modified oligoribonucleotides with immunomodulatory activity. The invention encompasses treatment of autoimmune and infectious diseases using the oligonucleotides of the invention.
Small molecule compounds and compositions containing said compounds useful for inhibiting signaling by certain Toll-like receptors (TLRs), particularly TLR9, are provided. The compounds and compositions can be used to inhibit immune responses, including unwanted immune responses in particular. Compounds, compositions, and methods are provided to treat a variety of conditions involving unwanted immune responses, including for example autoimmune disease, inflammation, transplant rejection, and sepsis.
C07D 401/14 - Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
20.
SUBSTITUTED CHIRAL FUSED( 1,2) IMIDAZO (4,5-C) RING COMPOUNDS AND METHODS
Substituted fused [l,2]imidazo[4,5-c] ring compounds (e.g., imidazo[4,5- c]quinolines, 6,7,8,9-tetrahydroimidazo[4,5-c]quinoIines, imidazo[4,5-c]naphthyridines, 6,7,8,9-tetrahydroimidazo[4,5-c]naphthyridines, and imidazo[4,5-c]pyridines ) with a -CHC-R2)- group in the fused ring at the 2-position of the imidazo ring and a.-CH(-Ri)- group in the fused ring at the 1 -position of the imidazo ring, pharmaceutical compositions containing the compounds, intermediates, methods of making the compounds, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/5365 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and at least one oxygen as the ring hetero atoms, e.g. 1,2-oxazines ortho- or peri-condensed with heterocyclic ring systems
6,7,8,9-Tetrahydro-1H-imidazo[4,5-c]naphthyridines with a substituent at the 6-, 7-, 8-, or 9-position nitrogen atom, pharmaceutical compositions containing these compounds, methods of making the compounds, intermediates, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
1H-Imidazo[4,5-c]naphthyridin-4-amines with a hydroxy, alkoxy, hydroxyalkoxy, or alkoxyalkoxy substituent at the 2-position, pharmaceutical compositions containing these compounds, methods of making the compounds, intermediates, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/437 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
A61K 31/4375 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having nitrogen as a ring hetero atom, e.g. quinolizines, naphthyridines, berberine, vincamine
[1,2]Imidazo[4,5-c] ring compounds (e.g., imidazo[4,5-c]quinolines, imidazo[4,5-c]naphthyridines, and imidazo[4,5-c]pyridines) substituted with a fused ring containing an oxygen and/or nitrogen atom attached at the 1- and/or 2-position, pharmaceutical compositions containing the compounds, intermediates, methods of making the compounds, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/4738 - QuinolinesIsoquinolines ortho- or peri-condensed with heterocyclic ring systems
A61K 31/5365 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and at least one oxygen as the ring hetero atoms, e.g. 1,2-oxazines ortho- or peri-condensed with heterocyclic ring systems
C07D 471/12 - Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups in which the condensed system contains three hetero rings
C07D 498/12 - Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and oxygen atoms as the only ring hetero atoms in which the condensed system contains three hetero rings
24.
COMPOSITIONS AND METHODS FOR OLIGONUCLEOTIDE FORMULATIONS
The present invention relates generally to imrnunostimulatory nucleic acids, compositions thereof and methods of using the imrnunostimulatory nucleic acids. In particular the invention relates to palindrome-containing imrnunostimulatory nucleic acids and the use of these nucleic acids in treating disease.
Methods for preparing compounds of the Formulas IV and I are disclosed. The methods include combining a compound of the Formula II: with a benzylamine of the Formula III: in the presence of an acid to provide a 1H-imidazo[4,5-c]pyridine compound of the Formula IV.
C07D 471/02 - Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups in which the condensed system contains two hetero rings
C07D 491/02 - Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups , , or in which the condensed system contains two hetero rings
C07D 498/02 - Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and oxygen atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
C07D 513/02 - Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups , or in which the condensed system contains two hetero rings
C07D 515/02 - Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen, oxygen, and sulfur atoms as the only ring hetero atoms, not provided for in groups , or in which the condensed system contains two hetero rings
The present invention provides a method of treating Hodgkin's lymphoma. Generally, the method includes administering to a patient with Hodgkin's lymphoma an amount of a TLR agonist compound effective to ameliorate at least one symptom or clinical sign of Hodgkin's lymphoma.
A61K 31/4738 - QuinolinesIsoquinolines ortho- or peri-condensed with heterocyclic ring systems
A61K 31/4745 - QuinolinesIsoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenanthrolines
A61K 31/4375 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having nitrogen as a ring hetero atom, e.g. quinolizines, naphthyridines, berberine, vincamine
The present invention provides a method for treating acute lymphoblastic leukemia. Generally, the method includes administering to a patient with ALL an amount of a TLR agonist compound effective to decrease the percentage of leukemic cells in the patient's peripheral blood or bone marrow.
Imidazo ring compounds, (e.g., imidazo⏧4,5-c]quinoline, 6,7,8,9-tetrahydro imidazo⏧4,5-c]quinoline, imidazo⏧4,5-c]naphthyridine, 6,7,8,9-tetrahydro imidazo⏧4,5-c]naphthyridine and imidazo⏧4,5-c]pyridine compounds) having a pyrazoloalkyl substituent at the 1-position, pharmaceutical compositions containing the compounds, intermediates, and methods of making and methods of use of these compounds as immunomodulators, for modulating cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed.
C07D 231/02 - Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
C07D 471/22 - Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups in which the condensed systems contains four or more hetero rings
A61K 31/4745 - QuinolinesIsoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenanthrolines
A61K 31/4738 - QuinolinesIsoquinolines ortho- or peri-condensed with heterocyclic ring systems
The present invention provides a method of treating Non-Hodgkin's lymphoma. Generally, the method includes administering to a patient with Non-Hodgkin's lymphoma an amount of a TLR agonist compound effective to ameliorate at least one symptom or clinical sign of Non-Hodgkin's lymphoma.
The present invention provides a method of treating acute myeloid leukemia. Generally, the method includes administering to a patient with AML an amount of a TLR agonist compound effective to decrease the percentage of leukemic cells in the patient's peripheral blood or bone marrow.
Certain 1H-imidazo[4,5-c]quinolines, 6,7,8,9-tetrahydro-1H-imidazo[4,5-c]quinolines, 1H-imidazo[4,5-c][1,5]naphthyridines, 6,7,8,9-tetrahydro-1H-imidazo[4,5-c][1,5]naphthyridines, and 1H-imidazo[4,5-c]pyridines substituted at the 1- and 2-positions, pharmaceutical compositions containing these compounds, methods of making the compounds, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/437 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
The present invention provides a method of activation murine TLR8. Generally, the method includes contacting a cell expressing the murine TLR8 with a first IRM compound that comprises a TLR8 agonist, and contacting the cell expressing the murine TLR8 with a second IRM compound, wherein the second IRM compound comprises an oligonucleotide sequence comprising at least seven bases in length wherein at least one base is a thymine or a uracil.
The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immnostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8).
C12N 15/11 - DNA or RNA fragmentsModified forms thereof
A61K 31/7105 - Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
A61K 9/127 - Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
A61P 31/00 - Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
1H-Imidazo⏧4,5-c]quinolin-4-amines with a hydroxy, alkoxy, hydroxyalkoxy, or alkoxyalkoxy substituent at the 2-position, pharmaceutical compositions containing these compounds, methods of making the compounds, intermediates, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
Methods and intermediates for preparing compounds of the Formulas: (I and X) are disclosed. The methods include a method providing a compound of the Formula: (IV) and converting a compound of Formula IV to a compound of Formula I, a method providing a compound of the Formula: (VIII) and converting a compound of Formula VIII to a compound of Formula I, and a method providing a compound of the Formula: (XI) and converting a compound of Formula XI to a compound of Formula I.
Amide and carbamate derivatives N-2-⏧4-amino-2-(ethoxymethyl)-1H-imidazo⏧4,5-c]quinolin-1-yl]-1,1-dimethylethyl}methanesulfonamide, pharmaceutical compositions containing these compounds, methods of making the compounds, and methods of use of these compounds in modulating the immune system, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
C07D 471/00 - Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups
38.
AMIDE AND CARBAMATE DERIVATIVES OF ALKYL SUBSTITUTED N-[4-(4-AMINO-1H-IMIDAZO[4,5-C]QUINOLIN-1-YL)BUTYL]METHANESULFONAMIDES AND METHODS
Amide and carbamate derivatives of N-[4-(4-amino-1H-imidazo[4,5-c]quinolin-1-yl)butyl]methanesulfonamides with an ethyl, methyl, or n-propyl substituent at the 2-position, pharmaceutical compositions containing these compounds, methods of making the compounds, and methods of use of these compounds in modulating the immune system, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed.
A61K 31/4745 - QuinolinesIsoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenanthrolines
A61K 31/541 - Non-condensed thiazines containing further heterocyclic rings
39.
ANTI-CTLA-4 ANTIBODY AND CPG-MOTIF-CONTAINING SYNTHETIC OLIGODEOXYNUCLEOTIDE COMBINATION THERAPY FOR CANCER TREATMENT
The invention relates to administration of an anti-CTLA-4 antibody, particularly human antibodies to human CTLA-4, such as those having amino acid sequences of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, 12.9.1.1, and MDX-010, in combination with an immunostimulatory nucleotide, i.e, CpG ODN PF3512676, for treatment of cancer. The invention relates to administering a combination of an anti-CTLA-4 antibody and CpG ODN PF3512676 as neoadjuvant, adjuvant, first-line, second-line, and third-line therapy of cancer, whether localized or metastasized, and at any point(s) along the disease continuum (e.g, at any stage of the cancer).
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
A61K 31/7088 - Compounds having three or more nucleosides or nucleotides
A61K 39/39 - Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
A61K 39/395 - AntibodiesImmunoglobulinsImmune serum, e.g. antilymphocytic serum
A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
C07H 21/02 - Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
C07H 21/04 - Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
patents
