A solventless pressure sensitive adhesive may include a silicone-based diluent component, an MQ resin component, a vinyl silicone component, and a crosslinker component. The silicone-based diluent component content may be at least about 0.1 wt. % and not greater than about 14 wt. % for a total weight of the solventless pressure sensitive adhesive, the MQ resin component content may be at least about 30 wt. % and not greater than about 65 wt. % for a total weight of the solventless pressure sensitive adhesive, the vinyl silicone component content may be at least about 27 wt. % and not greater than about 62 wt. % for a total weight of the solventless pressure sensitive adhesive, and the crosslinker component content may be at least about 0.5 wt. % and not greater than about 8.0 wt. % for a total weight of the solventless pressure sensitive adhesive.
C08G 77/00 - Composés macromoléculaires obtenus par des réactions créant dans la chaîne principale de la macromolécule une liaison contenant du silicium, avec ou sans soufre, azote, oxygène ou carbone
An electrochemical biosensor electrode includes a substrate; a base layer adjacent to the substrate, the base layer including an inert, non-noble metal; and a top layer adjacent to the base layer, the top layer including a noble metal, wherein the top layer has a thickness of not greater than 15 nanometers (nm).
G01N 33/66 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique faisant intervenir les sucres du sang, p. ex. le galactose
H01B 1/02 - Conducteurs ou corps conducteurs caractérisés par les matériaux conducteurs utilisésEmploi de matériaux spécifiés comme conducteurs composés principalement de métaux ou d'alliages
H01B 1/08 - Conducteurs ou corps conducteurs caractérisés par les matériaux conducteurs utilisésEmploi de matériaux spécifiés comme conducteurs composés principalement d'autres substances non métalliques oxydes
H01B 3/30 - Isolateurs ou corps isolants caractérisés par le matériau isolantEmploi de matériaux spécifiés pour leurs propriétés isolantes ou diélectriques composés principalement de substances organiques matières plastiquesIsolateurs ou corps isolants caractérisés par le matériau isolantEmploi de matériaux spécifiés pour leurs propriétés isolantes ou diélectriques composés principalement de substances organiques résinesIsolateurs ou corps isolants caractérisés par le matériau isolantEmploi de matériaux spécifiés pour leurs propriétés isolantes ou diélectriques composés principalement de substances organiques cires
3.
ADHESIVE COMPOSITION AND METHODS OF FORMING THE SAME
A solventless pressure sensitive adhesive may include a silicone-based diluent component, an MQ resin component, a vinyl silicone component, and a crosslinker component. The silicone-based diluent component content may be at least about 0.1 wt.% and not greater than about 14 wt.% for a total weight of the solventless pressure sensitive adhesive, the MQ resin component content may be at least about 30 wt.% and not greater than about 65 wt.% for a total weight of the solventless pressure sensitive adhesive, the vinyl silicone component content may be at least about 27 wt.% and not greater than about 62 wt.% for a total weight of the solventless pressure sensitive adhesive, and the crosslinker component content may be at least about 0.5 wt.% and not greater than about 8.0 wt.% for a total weight of the solventless pressure sensitive adhesive.
A blender assembly including: an inner member including a bearing oriented down a central axis; an outer member including a housing disposed at least partially exterior and concentric to the inner member; and at least one snap ring disposed radially between the inner member and the outer member, the at least one snap ring including: a snap ring body including a split annular body defining an aperture oriented down the central axis, where the snap ring body includes a substrate and a polymer layer overlying the substrate.
A47J 43/07 - Éléments ou parties constitutives, p. ex. outils pour mélanger ou pour battre
A47J 43/046 - Machines de ménage non prévues ailleurs, p. ex. pour moudre, mélanger, agiter, pétrir, émulsionner, fouetter ou battre les aliments, p. ex. actionnées par moteur à outils actionnés du côté du fond
5.
CELL CULTURE ARTICLES HAVING TEXTURED SURFACES AND USES THEREOF IN THE CULTURE OF ISLET CELLS AND BETA CELLS
This disclosure relates generally to cell culture articles (e.g., in the form of bags) having textured surfaces for growth of cells, e.g., in the form of organoids or spheroids. In one aspect, the disclosure provides a cell culture article having a first polymer film as a first boundary of a cell culture internal volume, the first polymer film having a plurality of pyramidal voids extending from a pyramid base at the inner surface or the outer surface of the first polymer film, to a pyramid tip, each of the pyramidal voids having a first base lateral dimension in the range of 150-2500 microns, a first tip lateral dimension up to 100 microns, and a depth in the range of 40-1000 microns, wherein the plurality of pyramidal voids forms a plurality of cell culture wells at the inner surface of the first polymer film.
The present disclosure relates to an impeller including: a post oriented down a central axis, the post including a balancing tip region; and a rotatable element including a plurality of blades, where at least one of the post or the rotatable element comprises a magnetic member, and where the rotatable element is configured to rotate about the post while being entirely supported on the balancing tip region of the post.
42 - Services scientifiques, technologiques et industriels, recherche et conception
Produits et services
Software as a service (SaaS) featuring non-downloadable software for enabling customers and professionals in the space, aerospace, nuclear, life sciences, industrial, semiconductor, automotive, energy, and hydrogen sectors to obtain recommendations on products best suited to their business needs.
42 - Services scientifiques, technologiques et industriels, recherche et conception
Produits et services
Software as a service (SaaS) featuring non-downloadable software for enabling customers and professionals in the space, aerospace, nuclear, life sciences, industrial, semiconductor, automotive, energy, and hydrogen sectors to obtain recommendations on products best suited to their business needs
9.
APPARATUS, SYSTEM, AND METHOD FOR STORING MEDICAL, PHARMACEUTICAL, OR BIOLOGICAL MEDIA
A apparatus including: a silicone-based body oriented down a central axis, the silicone-based body comprising: a rigid frame having a top axial surface and a bottom axial surface, an outer surface, and a substantially arcuate inner surface; and a plurality of gas-permeable, flexible film membranes connecting the inner surface about a perimeter of the rigid frame at the top axial surface and the bottom axial surface respectively to define an internal void within the body, wherein the rigid frame has a plurality of corrugations along the top axial surface and the bottom axial surface, and wherein the internal void provides for a medically, biologically, chemically, or pharmaceutically active environment.
A population of recycled silica particles includes: a plurality of individual silica particles, wherein the silica particles are hydrophobic. Further disclosed is a method of recycling a commercially available polymer article including: a) providing the commercially available polymer article; b) mechanically breaking the article into multiple polymer pieces, wherein the polymer includes at least one silicon-oxygen bond and a reinforcing silica filler; c) mixing a mixture including the polymer pieces, a solvent, and a catalyst, wherein the mixture provides a polymer oil and a population of recycled silica particles; and d) separating the polymer oil and the population of recycled silica particles from the mixture, wherein the population of recycled silica particles provides a plurality of individual silica particles.
C08J 11/28 - Récupération ou traitement des résidus des polymères par coupure des chaînes moléculaires des polymères ou rupture des liaisons de réticulation par voie chimique, p. ex. dévulcanisation par traitement avec une substance organique par traitement avec des composés organiques contenant de l'azote, du soufre ou du phosphore
A population of recycled silica particles includes: a plurality of individual silica particles, wherein the silica particles are hydrophobic. Further disclosed is a method of recycling a commercially available polymer article including: a) providing the commercially available polymer article; b) mechanically breaking the article into multiple polymer pieces, wherein the polymer includes at least one silicon-oxygen bond and a reinforcing silica filler; c) mixing a mixture including the polymer pieces, a solvent, and a catalyst, wherein the mixture provides a polymer oil and a population of recycled silica particles; and d) separating the polymer oil and the population of recycled silica particles from the mixture, wherein the population of recycled silica particles provides a plurality of individual silica particles.
A population of recycled silica particles includes: a plurality of individual silica particles, wherein the silica particles are hydrophobic. Further disclosed is a method of recycling a commercially available polymer article including: a) providing the commercially available polymer article; b) mechanically breaking the article into multiple polymer pieces, wherein the polymer includes at least one silicon-oxygen bond and a reinforcing silica filler; c) mixing a mixture including the polymer pieces, a solvent, and a catalyst, wherein the mixture provides a polymer oil and a population of recycled silica particles; and d) separating the polymer oil and the population of recycled silica particles from the mixture, wherein the population of recycled silica particles provides a plurality of individual silica particles.
C08J 11/28 - Récupération ou traitement des résidus des polymères par coupure des chaînes moléculaires des polymères ou rupture des liaisons de réticulation par voie chimique, p. ex. dévulcanisation par traitement avec une substance organique par traitement avec des composés organiques contenant de l'azote, du soufre ou du phosphore
C01B 33/18 - Préparation de silice finement divisée ni sous forme de sol ni sous forme de gelPost-traitement de cette silice
13.
APPARATUS, SYSTEM, AND METHOD FOR STORING MEDICAL, PHARMACEUTICAL, OR BIOLOGICAL MEDIA
A apparatus including: a silicone-based body oriented down a central axis, the silicone-based body comprising: a rigid frame having a top axial surface and a bottom axial surface, an outer surface, and a substantially arcuate inner surface; and a plurality of gas-permeable, flexible film membranes connecting the inner surface about a perimeter of the rigid frame at the top axial surface and the bottom axial surface respectively to define an internal void within the body, wherein the rigid frame has a plurality of corrugations along the top axial surface and the bottom axial surface, and wherein the internal void provides for a medically, biologically, chemically, or pharmaceutically active environment.
A61J 1/14 - Récipients spécialement adaptés à des fins médicales ou pharmaceutiques DétailsAccessoires à cet effet
A61J 1/05 - Récipients spécialement adaptés à des fins médicales ou pharmaceutiques pour recueillir, stocker ou administrer du sang, du plasma ou des liquides à usage médical
A population of recycled silica particles includes: a plurality of individual silica particles, wherein the silica particles are hydrophobic. Further disclosed is a method of recycling a commercially available polymer article including: a) providing the commercially available polymer article; b) mechanically breaking the article into multiple polymer pieces, wherein the polymer includes at least one silicon-oxygen bond and a reinforcing silica filler; c) mixing a mixture including the polymer pieces, a solvent, and a catalyst, wherein the mixture provides a polymer oil and a population of recycled silica particles; and d) separating the polymer oil and the population of recycled silica particles from the mixture, wherein the population of recycled silica particles provides a plurality of individual silica particles.
C08J 11/00 - Récupération ou traitement des résidus
C08J 11/18 - Récupération ou traitement des résidus des polymères par coupure des chaînes moléculaires des polymères ou rupture des liaisons de réticulation par voie chimique, p. ex. dévulcanisation par traitement avec une substance organique
C08J 11/08 - Récupération ou traitement des résidus des polymères sans réaction chimique utilisant des solvants sélectifs des constituants polymères
B29B 17/04 - Désintégration des matières plastiques
15.
APPARATUS, SYSTEM, AND METHOD FOR STORING MEDICAL, PHARMACEUTICAL, OR BIOLOGICAL MEDIA
An apparatus including: a core including an annular body defining an internal void oriented down a central axis having a top axial surface and a bottom axial surface; at least one retainer including an annular body adapted to couple to the top axial surface or the bottom axial surface of the core to form a circumferential engagement cavity defined radially between the at least one retainer and the core; at least one ring seal disposed within the engagement cavity; and at least one flexible film membrane partially disposed within the engagement cavity, where the at least one flexible film membrane at least partially encloses the internal void to provide for a medically, biologically, or pharmaceutically active environment within the internal void of the core.
An apparatus including: a core including an annular body defining an internal void oriented down a central axis having a top axial surface and a bottom axial surface; at least one retainer including an annular body adapted to couple to the top axial surface or the bottom axial surface of the core to form a circumferential engagement cavity defined radially between the at least one retainer and the core; at least one ring seal disposed within the engagement cavity; and at least one flexible film membrane partially disposed within the engagement cavity, where the at least one flexible film membrane at least partially encloses the internal void to provide for a medically, biologically, or pharmaceutically active environment within the internal void of the core.
A61J 1/05 - Récipients spécialement adaptés à des fins médicales ou pharmaceutiques pour recueillir, stocker ou administrer du sang, du plasma ou des liquides à usage médical
A61J 1/14 - Récipients spécialement adaptés à des fins médicales ou pharmaceutiques DétailsAccessoires à cet effet
The present application is directed to a filter including: a first housing member having a fluid inlet port; a second housing member positioned axially underneath the first housing member, the second housing member having a fluid outlet port; a porous filter element disposed between the first and second housing members; and a thermoplastic overmold which is molded over the periphery of the housing members sealing the periphery of the housing members together to form an internal volume housing the porous filter element, where the first housing member includes a radial sidewall comprising at least one axial step, and where the second housing member includes a substantially rectilinear radial sidewall
The present application is directed to a filter including: a first housing member having a fluid inlet port; a second housing member positioned axially underneath the first housing member, the second housing member having a fluid outlet port; a porous filter element disposed between the first and second housing members; and a thermoplastic overmold which is molded over the periphery of the housing members sealing the periphery of the housing members together to form an internal volume housing the porous filter element, where the first housing member includes a radial sidewall comprising at least one axial step, and where the second housing member includes a substantially rectilinear radial sidewall
B01D 29/05 - Filtres à éléments filtrants stationnaires pendant la filtration, p. ex. filtres à aspiration ou à pression, non couverts par les groupes Leurs éléments filtrants avec des éléments filtrants plats avec des supports
19.
BLADE FOR IMPELLER AND METHODS OF MAKING AND USING THE SAME
B01F 27/91 - Mélangeurs à agitateurs tournant dans des récipients fixesPétrins avec des agitateurs tournant autour d'un axe sensiblement vertical avec des hélices
B01F 27/072 - Agitateurs caractérisés par leur montage sur l’arbre caractérisés par la disposition des agitateurs par rapport à l'axe de rotation
B01F 27/113 - Agitateurs en forme d'hélice pour produire un écoulement axial, p. ex. en forme d'hélice de navire ou d'avion
B01F 27/1125 - Agitateurs caractérisés par la configuration des agitateurs avec des bras, des pales ou des lames avec des pales ou des lames s'étendant parallèlement ou obliquement par rapport à l'axe de l'agitateur
This disclosure relates generally to containers (such as bags) having surfaces comprising one or more aptamer sequences. More particularly, the present disclosure relates to containers such as bags comprising a fluoropolymer attached to aptamer sequences having binding affinity for one or more biological agents, and to transductions methods using such containers. In one aspect, the disclosure provides a container (e.g., a bag) having an outer surface and an inner surface, the inner surface comprising a fluoropolymer; attached to the fluoropolymer, a plurality of functional groups; and attached to each of at least a portion of the functional groups, a first aptamer sequence having a binding affinity for a viral vector.
The present disclosure relates to a multilayer composite that may include a foam layer, and a multilayer topcoat component overlying the foam layer. The multilayer topcoat component may include a first topcoat layer that includes a polyether polyurethane material, and a second topcoat layer that includes a hydrophobic polyurethane material. The second topcoat layer may overly the first topcoat layer, and the multilayer composite material may have a water resistance rating of at least about 10 hours.
The subject application relates to a composite material that may include a silicone-based matrix component, and a filler package component. The filler package component may include a first thermally conductive filler component and a second thermally conductive filler component. The first thermally conductive filler component may have an average particle size of at least about 30 microns and not greater than about 150 microns, and the second thermally conductive filler component may have an average particle size of at least about 1 micron and not greater than about 10 microns. The composite material may have a thermal conductivity of at least about 1.0 W/mk and not greater than about 5.0 W/mk.
The present disclosure relates to a multilayer composite that may include a foam layer, and a multilayer topcoat component overlying the foam layer. The multilayer topcoat component may include a first topcoat layer that includes a polyether polyurethane material, and a second topcoat layer that includes a hydrophobic polyurethane material. The second topcoat layer may overly the first topcoat layer, and the multilayer composite material may have a water resistance rating of at least about 10 hours.
The present disclosure relates to a method of forming a composite article. The method includes: providing a structural component with a surface, wherein the surface includes a silicone elastomer, a fluoropolymer, or a copolymer or a block copolymer; optionally pre-treating the surface with a plasma treatment; coating the surface of the structural component with a precursor coating component, wherein the precursor coating component including a polyvinyl alcohol based component, and treating the precursor coating component to form a crosslinked coating layer overlying the surface of the structural component.
B05D 1/18 - Procédés pour appliquer des liquides ou d'autres matériaux fluides aux surfaces par immersion
B05D 5/08 - Procédés pour appliquer des liquides ou d'autres matériaux fluides aux surfaces pour obtenir des effets, finis ou des structures de surface particuliers pour obtenir une surface antifriction ou anti-adhésive
B05D 7/02 - Procédés, autres que le flocage, spécialement adaptés pour appliquer des liquides ou d'autres matériaux fluides, à des surfaces particulières, ou pour appliquer des liquides ou d'autres matériaux fluides particuliers à des substances macromoléculaires, p. ex. à du caoutchouc
C08J 3/24 - Réticulation, p. ex. vulcanisation, de macromolécules
The subject application relates to an article and method of making. An article includes a polymer composition, the polymer composition including a silicone elastomer and a hydrogen peroxide degradation catalyst.
The subject application relates to an article and method of making. An article includes a polymer composition, the polymer composition including a silicone elastomer and a hydrogen peroxide degradation catalyst.
01 - Produits chimiques destinés à l'industrie, aux sciences ainsi qu'à l'agriculture
17 - Produits en caoutchouc ou en matières plastiques; matières à calfeutrer et à isoler
Produits et services
Polymer material alloy powder for molding and forming
semi-finished products. Seals, gaskets, O'rings and sealing devices made from
polymer materials; polymer resin sheets, tubes, and rods.
A fastener including: a sidewall oriented about a central axis, the sidewall including at least one of 1) at least one first type of deformable projection comprising a teardrop shaped radial face, or 2) an arcuate portion, a radial corrugation portion, and a circumferential corrugation portion, where the sidewall is a layered structure including a substrate and an insulating layer overlying the substrate.
A fastener including: a sidewall oriented about a central axis, the sidewall including at least one of 1) at least one first type of deformable projection comprising a teardrop shaped radial face, or 2) an arcuate portion, a radial corrugation portion, and a circumferential corrugation portion, where the sidewall is a layered structure including a substrate and an insulating layer overlying the substrate.
F16B 21/07 - Dispositifs de fixation largables à action rapide dans lesquels la douille a une partie élastique
F16B 2/04 - Brides ou colliers, c.-à-d. dispositifs de fixation dont le serrage est effectué par des forces effectives autres que la résistance à la déformation inhérente au matériau dont est fait le dispositif internes, c.-à-d. agissant par expansion
30.
COMPOSITE MATERIAL, COMPOSITE MATERIAL LAYER, AND CELL VENT PROTECTION COMPOSITE WITH THERMAL BARRIER PROPERTIES
The subject application relates to composite material, composite material layer, and cell vent protection composite with thermal barrier properties. The subject application relates to a composite material that may include a silicone-based matrix component, a reinforcing filler component distributed within the silicone-based matrix component, and a ceramization filler composition distributed within the silicone-based matrix component. The ceramization filler composition may include a ceramization filler component, a structure promoter component, a flux component, and a flame retardant component.
C08G 77/08 - Procédés de préparation caractérisés par les catalyseurs utilisés
C08G 77/12 - Polysiloxanes contenant du silicium lié à l'hydrogène
C08G 77/20 - Polysiloxanes contenant du silicium lié à des groupes aliphatiques non saturés
C08J 9/06 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent chimique de gonflage
H01M 10/658 - Moyens de commande de la température associés de façon structurelle avec les éléments par isolation ou protection thermique
31.
COMPOSITE MATERIAL, COMPOSITE MATERIAL LAYER, AND THERMAL BARRIER COMPOSITE WITH THERMAL BARRIER PROPERTIES
The subject application relates to composite material, composite material layer, and thermal barrier composite with thermal barrier properties. The subject application relates to a composite material that may include a silicone-based matrix component, a reinforcing filler component distributed within the silicone-based matrix component, and a ceramization filler composition distributed within the silicone-based matrix component. The ceramization filler composition may include a ceramization filler component, a structure promoter component, a flux component, and a flame retardant component.
C08G 77/08 - Procédés de préparation caractérisés par les catalyseurs utilisés
C08J 9/00 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement
C08J 9/12 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent physique de gonflage
The subject application relates to composite material, composite material layer, and cell vent protection composite with thermal barrier properties. The subject application relates to a composite material that may include a silicone-based matrix component, a reinforcing filler component distributed within the silicone-based matrix component, and a ceramization filler composition distributed within the silicone-based matrix component. The ceramization filler composition may include a ceramization filler component, a structure promoter component, a flux component, and a flame retardant component.
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
C08J 9/06 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent chimique de gonflage
C08J 9/10 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent chimique de gonflage dégageant de l'azote
33.
COMPOSITE MATERIAL, COMPOSITE MATERIAL LAYER, AND THERMAL BARRIER COMPOSITE WITH THERMAL BARRIER PROPERTIES
The subject application relates to composite material, composite material layer, and thermal barrier composite with thermal barrier properties. The subject application relates to a composite material that may include a silicone-based matrix component, a reinforcing filler component distributed within the silicone-based matrix component, and a ceramization filler composition distributed within the silicone-based matrix component. The ceramization filler composition may include a ceramization filler component, a structure promoter component, a flux component, and a flame retardant component.
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
C08J 9/06 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent chimique de gonflage
C08J 9/10 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent chimique de gonflage dégageant de l'azote
34.
COATED ARTICLE FOR CULTURING PRIMARY CELLS AND STEM CELLS AND METHOD FOR PREPARING THE SAME
The invention relates to a coated article for culturing primary cells and stem cells, said coated article comprising a cell culture scaffold material with a non-covalent coating, said non-covalent coating comprises or consists of at least one layer consisting of at least one negatively charged polysaccharide and a layer consisting of a positively charged conjugate. The invention further relates to a method of preparing said coated article and its use in regenerative medicine, gene and cell therapy, aesthetic medicine, or cellular agriculture.
C12M 1/12 - Appareillage pour l'enzymologie ou la microbiologie avec des moyens de stérilisation, filtration ou dialyse
C12M 1/00 - Appareillage pour l'enzymologie ou la microbiologie
C12N 5/00 - Cellules non différenciées humaines, animales ou végétales, p. ex. lignées cellulairesTissusLeur culture ou conservationMilieux de culture à cet effet
A tube including: at least one inner fluoropolymer layer, where the at least one inner fluoropolymer layer includes a first fluoropolymer having a melting temperature of about 140° C. to 200° C., and at least one outer fluoropolymer layer overlying the inner fluoropolymer layer, the at least one outer fluoropolymer layer having an inner surface and an outer surface where the outer fluoropolymer layer includes a second fluoropolymer having a heat shrink temperature of less than 250° C., where the tube has a working temperature up to 180° C., where the at least one outer fluoropolymer layer has a shrink ratio of at least 1.5:1 along the inner surface of the at least one outer fluoropolymer layer.
F16L 11/12 - Manches, c.-à-d. tuyaux flexibles en caoutchouc ou en matériaux plastiques flexibles avec agencements pour usages particuliers, p. ex. spécialement profilés, avec couche protectrice, chauffés, conducteurs d'électricité
B29C 48/00 - Moulage par extrusion, c.-à-d. en exprimant la matière à mouler dans une matrice ou une filière qui lui donne la forme désiréeAppareils à cet effet
B29C 48/10 - Objets dont la section transversale comporte des cavités partiellement ou entièrement fermées, p. ex. tuyaux ou canaux flexibles, p. ex. pellicules flexibles soufflées
B29C 48/21 - Articles comprenant au moins deux composants, p. ex. couches coextrudées les composants étant des couches les couches étant jointes à leurs surfaces
B29K 27/00 - Utilisation de polyhalogénures de vinyle comme matière de moulage
B29K 27/12 - Utilisation de polyhalogénures de vinyle comme matière de moulage contenant du fluor
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
B32B 27/30 - Produits stratifiés composés essentiellement de résine synthétique comprenant une résine vinyliqueProduits stratifiés composés essentiellement de résine synthétique comprenant une résine acrylique
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
A tube including: at least one inner fluoropolymer layer, where the at least one inner fluoropolymer layer includes a first fluoropolymer having a melting temperature of about 140°C to 200°C, and at least one outer fluoropolymer layer overlying the inner fluoropolymer layer, the at least one outer fluoropolymer layer having an inner surface and an outer surface where the outer fluoropolymer layer includes a second fluoropolymer having a heat shrink temperature of less than 250°C, where the tube has a working temperature up to 180°C, where the at least one outer fluoropolymer layer has a shrink ratio of at least 1.5:1 along the inner surface of the at least one outer fluoropolymer layer.
B29C 48/09 - Objets dont la section transversale comporte des cavités partiellement ou entièrement fermées, p. ex. tuyaux ou canaux
B29C 48/16 - Articles comprenant au moins deux composants, p. ex. couches coextrudées
B29C 48/15 - Moulage par extrusion, c.-à-d. en exprimant la matière à mouler dans une matrice ou une filière qui lui donne la forme désiréeAppareils à cet effet incorporant des éléments ou des couches préformés, p. ex. moulage par extrusion autour d’inserts
An adhesive may include an adhesive structure and an adhesive composition. The adhesive structure may include a graft copolymer. The adhesive composition may include at least about 1 wt. % and not greater than 40 wt. % of a macromonomer component for a total weight of the adhesive composition, at least about 50 wt. % and not greater than about 98 wt. % of a (meth)acrylic based polymeric component A for a total weight of the adhesive composition, and at least about 0.1 wt. % and not greater than about 30 wt. % of a tackifier component for a total weight of the adhesive composition. The macromonomer component may have a weight-average molecular weight of at least 1000 g/mol and a glass transition temperature (Tg) of at least about 40° C. The (meth)acrylic based polymeric component A may have a glass transition temperature (Tg) of not greater than about 20° C.
C09J 151/00 - Adhésifs à base de polymères greffés dans lesquels le composant greffé est obtenu par des réactions faisant intervenir uniquement des liaisons non saturées carbone-carboneAdhésifs à base de dérivés de tels polymères
C08F 2/50 - Polymérisation amorcée par énergie ondulatoire ou par rayonnement corpusculaire par la lumière ultraviolette ou visible avec des agents sensibilisants
C08F 220/06 - Acide acryliqueAcide méthacryliqueLeurs sels métalliques ou leurs sels d'ammonium
C08F 220/18 - Esters des alcools ou des phénols monohydriques des phénols ou des alcools contenant plusieurs atomes de carbone avec l'acide acrylique ou l'acide méthacrylique
C08F 236/20 - Copolymères de composés contenant plusieurs radicaux aliphatiques non saturés et l'un au moins contenant plusieurs liaisons doubles carbone-carbone le radical ne contenant que deux doubles liaisons carbone-carbone non conjuguées
C08F 236/22 - Copolymères de composés contenant plusieurs radicaux aliphatiques non saturés et l'un au moins contenant plusieurs liaisons doubles carbone-carbone le radical contenant au moins trois doubles liaisons carbone-carbone
C09J 133/08 - Homopolymères ou copolymères d'esters de l'acide acrylique
C09J 133/10 - Homopolymères ou copolymères d'esters de l'acide méthacrylique
G01R 23/00 - Dispositions pour procéder aux mesures de fréquencesDispositions pour procéder à l'analyse de spectres de fréquences
G01R 31/00 - Dispositions pour tester les propriétés électriquesDispositions pour la localisation des pannes électriquesDispositions pour tests électriques caractérisées par ce qui est testé, non prévues ailleurs
G01R 31/30 - Tests marginaux, p. ex. en faisant varier la tension d'alimentation
H04L 9/32 - Dispositions pour les communications secrètes ou protégéesProtocoles réseaux de sécurité comprenant des moyens pour vérifier l'identité ou l'autorisation d'un utilisateur du système
38.
AEROGEL-BASED LAYER, COMPOSITE MATERIAL, AND ADHESIVE TAPE
The present disclosure relates to an aerogel-based layer may include a silicone-based binder component at a content of at least about 10 wt.% and not greater than about 90 wt.% for a total weight of the aerogel-based layer, and an aerogel component at a content of at least about 10 wt.% and not greater than about 90 wt.% for a total weight of the aerogel-based layer.
The present disclosure relates to an aerogel-based layer may include a silicone-based binder component at a content of at least about 10 wt. % and not greater than about 90 wt. % for a total weight of the aerogel-based layer, and an aerogel component at a content of at least about 10 wt. % and not greater than about 90 wt. % for a total weight of the aerogel-based layer.
The present disclosure relates to a pressure sensitive adhesive may include a polyisobutylene-based material, and a peroxide based additive. The pressure sensitive adhesive may have an Adhesive Electrolyte Exposure Peel Force (AEEPF) of at least about 0.5 N/cm.
A pressure sensitive adhesive composite material may include a pressure sensitive adhesive layer that may include a pressure sensitive adhesive material, and a scrim layer that may include a grid of fibers. The scrim layer may be encased within the pressure sensitive adhesive layer. The pressure sensitive adhesive composite material may include a grid region of the fibers coated with the pressure sensitive adhesive material, and a plurality of window regions of the pressure sensitive adhesive material between the fibers. An average thickness of the plurality of widow regions is less than an average thickness of the grid region.
The present disclosure relates to a pressure sensitive adhesive may include a polyisobutylene-based material, and a peroxide based additive. The pressure sensitive adhesive may have an Adhesive Electrolyte Exposure Peel Force (AEEPF) of at least about 0.5 N/cm.
01 - Produits chimiques destinés à l'industrie, aux sciences ainsi qu'à l'agriculture
17 - Produits en caoutchouc ou en matières plastiques; matières à calfeutrer et à isoler
Produits et services
(1) Polymer material alloy powder for molding and forming semi-finished products.
(2) Seals, gaskets, O'rings and sealing devices made from polymer materials; polymer resin sheets, tubes, and rods.
44.
ADHESIVE COMPOSITE MATERIAL AND METHODS OF FORMING THE SAME
A pressure sensitive adhesive composite material may include a pressure sensitive adhesive layer that may include a pressure sensitive adhesive material, and a scrim layer that may include a grid of fibers. The scrim layer may be encased within the pressure sensitive adhesive layer. The pressure sensitive adhesive composite material may include a grid region of the fibers coated with the pressure sensitive adhesive material, and a plurality of window regions of the pressure sensitive adhesive material between the fibers. An average thickness of the plurality of widow regions is less than an average thickness of the grid region.
01 - Produits chimiques destinés à l'industrie, aux sciences ainsi qu'à l'agriculture
17 - Produits en caoutchouc ou en matières plastiques; matières à calfeutrer et à isoler
Produits et services
Polymer material alloy powder being polymer alloy compositions in powder form used for molding and forming semi-finished products Non-metal seals for joints, gaskets, o-rings, and sealing gaskets, all made from polymer materials; Polymer resin in sheets, tubes, and rods for general industrial use
This disclosure relates to polysiloxanes and polysiloxane compositions having dual-curable properties, to methods for forming articles from such compositions, and to articles formed thereby. In one embodiment, the polysiloxane comprises at least about two alkenyl groups and at least about two (meth)acryloyl groups.
B33Y 70/00 - Matériaux spécialement adaptés à la fabrication additive
C08G 77/12 - Polysiloxanes contenant du silicium lié à l'hydrogène
C08G 77/20 - Polysiloxanes contenant du silicium lié à des groupes aliphatiques non saturés
G03F 7/00 - Production par voie photomécanique, p. ex. photolithographique, de surfaces texturées, p. ex. surfaces impriméesMatériaux à cet effet, p. ex. comportant des photoréservesAppareillages spécialement adaptés à cet effet
The present disclosure relates to a multilayer gasket that may include a core layer, and a first outer layer overlying a first surface of the core layer. The first outer layer may include a low-melt fluoropolymer material having a melting temperature of not greater than about 300° C.
F16J 15/10 - Joints d'étanchéité entre surfaces immobiles entre elles avec garniture solide comprimée entre les surfaces à joindre par garniture non métallique
The present disclosure relates to a multilayer gasket that may include a core layer, and a first outer layer overlying a first surface of the core layer. The first outer layer may include a low-melt fluoropolymer material having a melting temperature of not greater than about 300 ˚C.
The disclosure relates generally to a cell culture apparatus and a cell culture method. One aspect of the disclosure provides a perfusion cell culture bag comprising one or more polymer films, having edges bonded together to form edges around an undivided interior compartment of the bag; first and second ports each formed in an exterior surface of the bag; first and second liquid-permeable tubes each extending into and in fluid communication with the interior compartment of the bag and operatively coupled to a respective port; and a third port formed in an exterior surface of the bag, the third port being in fluid communication with the interior compartment of the bag; wherein the first tube comprises a first inner support structure defining a central lumen of the tube and a first outer filter layer surrounding the first inner support structure.
A rotary shaft seal including an annular body having an aperture defining a central axis and an inner surface; a shaft disposed within the aperture of the annular body; and a sealing element positioned at least partially between the shaft and the annular body, where the sealing element is configured to form a seal between the annular body and the shaft, where the sealing element includes a body having a U-shaped or a V-shaped cross-section including a plurality of lips, where at least one lip of the sealing element is fixed to at least one of the shaft or the annular body, and where a cavity exists between at least one of the plurality of lips and at least one of the shaft or the annular body.
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
F16J 15/3228 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre formée par déformation d’une bague plate
A rotary shaft seal including an annular body having an aperture defining a central axis and an inner surface; a shaft disposed within the aperture of the annular body; and a sealing element positioned at least partially between the shaft and the annular body, where the sealing element is configured to form a seal between the annular body and the shaft, where the sealing element includes a body having a U-shaped or a V-shaped cross-section including a plurality of lips, where at least one lip of the sealing element is fixed to at least one of the shaft or the annular body, and where a cavity exists between at least one of the plurality of lips and at least one of the shaft or the annular body.
F16J 15/3204 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
The present disclosure relates to a composite article that may include a structural substrate, a multilayer fluoropolymer film that can include a high-melt fluoropolymer layer and a low-melt fluoropolymer adhesion layer that may contact the structural substrate and the fluoropolymer film. The high-melt fluoropolymer layer may have a melting temperature A1 and the low-melt fluoropolymer adhesive layer may have a melting temperature A2. The melting temperature A2 may be less than the melting temperature A1.
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
F16J 15/02 - Joints d'étanchéité entre surfaces immobiles entre elles
F16F 1/02 - Ressorts en acier ou faits d'un autre matériau ayant une faible friction intérieureRessorts enroulés, de torsion, à lame, en forme de coupelles, à corps annulaire ou similaire, le matériau de ressort ne jouant pas de rôle
F16F 1/373 - Ressorts en matière plastique, p. ex. en caoutchoucRessorts faits d'un matériau à friction intérieure élevée caractérisés par une forme particulière
57.
ENERGIZING ELEMENT AND METHODS OF MAKING AND USING THE SAME
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
A peristaltic pump tube (100) includes a silicone composition including a base silicone material, an accelerator, a curing agent, and a catalyst, wherein the base silicone material includes a blend of a first silicone elastomer and a second silicone elastomer, wherein the first silicone elastomer has a shore A durometer that is different than a shore A durometer of the second silicone elastomer; wherein the peristaltic pump tube (100) is used with a peristaltic pump at rotator speeds of greater than 600 rotations per minute, and the silicone composition advantageously increases pump life of the peristaltic pump tube (100).
The present disclosure relates to a multilayer composite or multilayer laminate that may include a core foam layer, and a first ceramifiable barrier component contacting the core foam layer. The ceramifiable barrier component may include a ceramifiable layer. The multilayer composite may have a HBF flammability rating as measured according to ASTM D4986.
B32B 5/02 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par les caractéristiques de structure d'une couche comprenant des fibres ou des filaments
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
B32B 5/24 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par la présence de plusieurs couches qui comportent des fibres, filaments, grains ou poudre, ou qui sont sous forme de mousse ou essentiellement poreuses une des couches étant fibreuse ou filamenteuse
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 27/12 - Produits stratifiés composés essentiellement de résine synthétique adjacente à une couche fibreuse ou filamenteuse
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
C08J 9/00 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement
The present disclosure relates to a multilayer composite or multilayer laminate that may include a core foam layer, and a first ceramifiable barrier component contacting the core foam layer. The ceramifiable barrier component may include a ceramifiable layer. The multilayer composite may have a HBF flammability rating as measured according to ASTM D4986.
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
B32B 27/28 - Produits stratifiés composés essentiellement de résine synthétique comprenant des copolymères de résines synthétiques non complètement couverts par les sous-groupes suivants
A linear motion assembly including: a first component; a second component; and a sliding member disposed between the first and second components; and a retention system adapted to retain the sliding member between the first component and the second component, where the retention system includes a retention frame and at least one spring element, where the sliding member is disposed between the retention frame and the spring element, where the spring element provides a biasing force on the sliding member.
A linear motion assembly including: a first component; a second component; and a sliding member disposed between the first and second components; and a retention system adapted to retain the sliding member between the first component and the second component, where the retention system includes a retention frame and at least one spring element, where the sliding member is disposed between the retention frame and the spring element, where the spring element provides a biasing force on the sliding member.
A seal including: an annular jacket including an annular jacket including a body including a heel, a first lip, and a second lip defining an annular recess oriented down a central axis, where the first lip is substantially parallel to the central axis, where the second lip includes an angled portion adjacent to the heel and a planar portion adjacent to the angled portion, where the angled portion forms an angle, α, with a line perpendicular to the central axis, where α is between 30 and 90°, where the heel has an axial length, LH, where the first lip has an axial length, LFL, and where LH≤3 LFL.
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
65.
SELF ENERGIZED SEAL AND METHODS OF MAKING AND USING THE SAME
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3248 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques pourvus d’armatures ou de supports
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
17 - Produits en caoutchouc ou en matières plastiques; matières à calfeutrer et à isoler
Produits et services
Multimaterial plastic flexible composites, in the form of rolls and converted pieces; non-metal flexible reinforcement materials and unsupported plastic films having thermal chemical and weathering resistance and having release, friction, protection and dielectric insulation properties and multilayer composite products, composed of polymer-based plastics, flexible plastic reinforcement materials, unsupported plastic films for use in manufacturing in the mobility, industrial, communications, electronics, renewable energy, medical, safety and defense and architectural industries.
A seal including: a metal annular body oriented down a central axis, the metal annular body comprising an axially elongated heel flange, a first lip, and a second lip defining an annular recess that bisects the central axis, wherein a radial midpoint of the axially elongated heel flange is radially offset from the central axis, a radial midpoint of the first lip, and a radial midpoint of the second lip.
F16J 15/34 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par bague glissante pressée contre la face plus ou moins radiale d'une des deux parties
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
68.
MULTILAYER LAMINATE STRUCTURE AND METHOD OF FORMING THE SAME
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an encapsulant layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The encapsulant layer comprises an encapsulant component and a first encapsulant layer ultra violet (UV) absorber component.
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
B32B 27/18 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
B32B 27/36 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyesters
B32B 37/16 - Procédés ou dispositifs pour la stratification, p. ex. par polymérisation ou par liaison à l'aide d'ultrasons caractérisés par les propriétés des couches toutes les couches existant et présentant une cohésion avant la stratification
C08J 5/12 - Fixation d'un matériau macromoléculaire préformé au même matériau ou à un autre matériau compact, tel que du métal, du verre, du cuir, p. ex. en utilisant des adhésifs
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an encapsulant layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The encapsulant layer comprises an encapsulant component and a first encapsulant layer ultra violet (UV) absorber component.
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
C09K 3/10 - Substances non couvertes ailleurs pour sceller ou étouper des joints ou des couvercles
H10K 77/10 - Substrats, p. ex. substrats flexibles
A seal including: a metal annular body oriented down a central axis, the metal annular body comprising an axially elongated heel flange, a first lip, and a second lip defining an annular recess that bisects the central axis, wherein a radial midpoint of the axially elongated heel flange is radially offset from the central axis, a radial midpoint of the first lip, and a radial midpoint of the second lip.
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
17 - Produits en caoutchouc ou en matières plastiques; matières à calfeutrer et à isoler
19 - Matériaux de construction non métalliques
Produits et services
Multimaterial plastic flexible composites made primarily of plastic composite material in the form of rolls and converted pieces in the form of profiles, boards, sheets, blocks, rods, powder, and pellets for use in manufacturing; non-metal flexible plastic reinforcement materials, unsupported plastic films having thermal chemical and weathering resistance and having release, friction, protection and dielectric insulation properties and multilayer composites composed of polymer-based plastics, flexible plastic reinforcement materials, unsupported plastic films, all of the foregoing in the form of bars, blocks, pellets, rods, sheets and tubes for use in manufacturing in the mobility, industrial, communications, electronics, renewable energy, medical, safety and defense and architectural industries Multimaterial non-metal plastic flexible composite blocks for building
72.
FILLER COMPOSITION, COMPOSITE MATERIAL AND COMPOSITE MATERIAL LAYER WITH THERMAL BARRIER PROPERTIES
The subject application relates to a filler composition, composite material and composite material layer with thermal barrier properties. The present disclosure relates to a filler composition may include a ceramization filler component at a content of at least about 75 wt. % and not greater than about 95 wt. % for a total weight of the filler composition, a structure promoter component at a content of at least about 0.1 wt. % and not greater than about 7.0 wt. % for a total weight of the filler composition, a flux component at a content of at least about 0.1 wt. % and not greater than about 7.0 wt. % for a total weight of the filler composition, and a flame retardant component at least about 5.0 wt. % and not greater than about 20.0 wt. % for a total weight of the filler composition.
The subject application relates to a filler composition, composite material and composite material layer with thermal barrier properties. The present disclosure relates to a filler composition may include a ceramization filler component at a content of at least about 50 wt. % and not greater than about 90 wt. % for a total weight of the filler composition, a reinforcement component at a content of at least about 0.1 wt. % and not greater than about 10.0 wt. % for a total weight of the filler composition, a flux component at a content of at least about 3.0 wt. % and not greater than about 10.0 wt. % for a total weight of the filler composition, and a flame retardant component at least about 5.0 wt. % and not greater than about 20.0 wt. % for a total weight of the filler composition.
The subject application relates to a filler composition, composite material and composite material layer with thermal barrier properties. The present disclosure relates to a filler composition may include a ceramization filler component at a content of at least about 50 wt.% and not greater than about 90 wt.% for a total weight of the filler composition, a reinforcement component at a content of at least about 0.1 wt.% and not greater than about 10.0 wt.% for a total weight of the filler composition, a flux component at a content of at least about 3.0 wt.% and not greater than about 10.0 wt.% for a total weight of the filler composition, and a flame retardant component at least about 5.0 wt.% and not greater than about 20.0 wt.% for a total weight of the filler composition.
The subject application relates to a filler composition, composite material and composite material layer with thermal barrier properties. The present disclosure relates to a filler composition may include a ceramization filler component at a content of at least about 75 wt.% and not greater than about 95 wt.% for a total weight of the filler composition, a structure promoter component at a content of at least about 0.1 wt.% and not greater than about 7.0 wt.% for a total weight of the filler composition, a flux component at a content of at least about 0.1 wt.% and not greater than about 7.0 wt.% for a total weight of the filler composition, and a flame retardant component at least about 5.0 wt.% and not greater than about 20.0 wt.% for a total weight of the filler composition.
A liquid recovery filter assembly for recovering filtered liquid trapped within a core or downstream side of a filter element. Multiple embodiments each include a recovery port and a recovery filter in fluid communication with the core or downstream side of the filter element. The recovery port is opened following filtration operations to permit and to facilitate filtered liquid to flow from a downstream or outlet port, thus allowing recovery of liquid remaining in the filter core or downstream side following filtering operations. The recovery filter permits the introduction of pressurized gas to force the filtered liquids from the filter assembly without compromising the sterility and/or non-contaminant condition of the liquid. Additional aspects include exchangeable filter cartridges or filter elements in single and multi-round configurations, embodiments with aspiration tubes and dip tubes and still others with hydrophilic/hydrophobic recovery filters that function as filters and as valves for the recovery port.
B01D 29/21 - Éléments filtrants avec des supports agencés pour la filtration à courant dirigé vers l'intérieur à feuilles ondulées, pliées ou enroulées
B01D 29/52 - Filtres à éléments filtrants stationnaires pendant la filtration, p. ex. filtres à aspiration ou à pression, non couverts par les groupes Leurs éléments filtrants à plusieurs éléments filtrants caractérisés par leur agencement relatif montés en parallèle
B01D 29/58 - Filtres à éléments filtrants stationnaires pendant la filtration, p. ex. filtres à aspiration ou à pression, non couverts par les groupes Leurs éléments filtrants à plusieurs éléments filtrants caractérisés par leur agencement relatif montés en série disposés de façon concentrique ou coaxiale
B01D 29/90 - Filtres à éléments filtrants stationnaires pendant la filtration, p. ex. filtres à aspiration ou à pression, non couverts par les groupes Leurs éléments filtrants comportant des dispositifs d'alimentation ou d'évacuation d'alimentation
The disclosure relates to coated surfaces suitable for cell culture, to methods for making such surfaces, and to methods for culturing adherent cells on such surfaces. One aspect of the disclosure is a surface suitable for cell culture including an amorphous hydrogenated carbon coating. Another aspect of the disclosure is a method for making a surface suitable for cell culture including an amorphous hydrogenated carbon coating. Another aspect of the disclosure is a method for culturing adherent cells that includes incubating a surface including an amorphous hydrogenated carbon coating with adherent cells and a growth medium.
This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).
This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).
The disclosure relates to coated surfaces suitable for cell culture, to methods for making such surfaces, and to methods for culturing adherent cells on such surfaces. One aspect of the disclosure is a surface suitable for cell culture including an amorphous hydrogenated carbon coating. Another aspect of the disclosure is a method for making a surface suitable for cell culture including an amorphous hydrogenated carbon coating. Another aspect of the disclosure is a method for culturing adherent cells that includes incubating a surface including an amorphous hydrogenated carbon coating with adherent cells and a growth medium.
The present disclosure related to a silicone-based foam may include a component A and a component B, where the component A may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, and a third filler component that may include calcium carbonate, and where the component B may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, a third filler component that may include calcium carbonate, and a fourth filler component that may include zinc borate. The silicone-based foam may have a V-0 flammability rating as measured according to ASTM D3801.
The present disclosure related to a multilayer composite that may include a first polymethylpentene (TPX) liner, and a silicone-based foam layer overlying the first TPX liner. The silicone-based foam layer may include a component A and a component B, where the component A may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, and a third filler component that may include calcium carbonate, and where the component B may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, a third filler component that may include calcium carbonate, and a fourth filler component that may include zinc borate. The silicone-based foam layer may have a V-0 flammability rating as measured according to ASTM D3801.
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
C08J 9/00 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement
C08J 9/14 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent physique de gonflage organique
The present disclosure related to a silicone-based foam may include a component A and a component B, where the component A may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, and a third filler component that may include calcium carbonate, and where the component B may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, a third filler component that may include calcium carbonate, and a fourth filler component that may include zinc borate. The silicone-based foam may have a V-0 flammability rating as measured according to ASTM D3801.
C08J 9/00 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement
C08G 77/08 - Procédés de préparation caractérisés par les catalyseurs utilisés
C08G 77/20 - Polysiloxanes contenant du silicium lié à des groupes aliphatiques non saturés
C08J 9/14 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent physique de gonflage organique
The present disclosure related to a multilayer composite that may include a first polymethylpentene (TPX) liner, and a silicone-based foam layer overlying the first TPX liner. The silicone-based foam layer may include a component A and a component B, where the component A may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, and a third filler component that may include calcium carbonate, and where the component B may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, a third filler component that may include calcium carbonate, and a fourth filler component that may include zinc borate. The silicone-based foam layer may have a V-0 flammability rating as measured according to ASTM D3801.
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 5/20 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux la structure sous forme de mousse étant réalisée sur place
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
C08G 77/08 - Procédés de préparation caractérisés par les catalyseurs utilisés
C08G 77/20 - Polysiloxanes contenant du silicium lié à des groupes aliphatiques non saturés
C08J 9/00 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement
C08J 9/14 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent physique de gonflage organique
A polyurethane foam may include a base polyol component, a phosphorous polyol component, an expandable graphite, and melamine. The polyurethane foam may have a VO rating based on a UL94 flame retardancy test performed at a polyurethane foam thickness of 3.5 mm and a polyurethane foam density of 380 kg/m3.
Embodiments described herein are generally directed to an annular seal including: an annular body defining a cross-section down a central axis, the annular body including: a first linear section oriented down a first plane; a first portion contiguous with the first end of the first linear section, the first portion being curved with respect to the first linear section and in accordance with a first predetermined radius, the first portion extending to a first distal end; a second portion contiguous with the second end of the first linear section, the second portion including: a second linear section oriented down a second plane non-parallel to the first plane; and at least one discrete, radially-oriented tab contiguous with the second linear section and oriented along a circumference of the annular body.
F16J 15/10 - Joints d'étanchéité entre surfaces immobiles entre elles avec garniture solide comprimée entre les surfaces à joindre par garniture non métallique
F16J 15/08 - Joints d'étanchéité entre surfaces immobiles entre elles avec garniture solide comprimée entre les surfaces à joindre exclusivement par garniture métallique
Embodiments described herein are generally directed to an annular seal including: an annular body defining a cross-section down a central axis, the annular body including: a first linear section oriented down a first plane; a first portion contiguous with the first end of the first linear section, the first portion being curved with respect to the first linear section and in accordance with a first predetermined radius, the first portion extending to a first distal end; a second portion contiguous with the second end of the first linear section, the second portion including: a second linear section oriented down a second plane non-parallel to the first plane; and at least one discrete, radially-oriented tab contiguous with the second linear section and oriented along a circumference of the annular body.
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
The present invention relates to a nut for a connector assembly for a tube including: an annular nut body including a polymer and oriented down a central axis, the annular nut body including: a circumferential split defining a first circumferential portion and a second circumferential portion, where the first circumferential portion and the second circumferential portion are flexibly connected by a pliable bridge portion, where the first circumferential portion includes a first circumferential end and the second circumferential portion includes a second circumferential end, where the first circumferential end and the second circumferential end each include a coupling component adapted to fix the first circumferential end and the second circumferential end together.
F16L 19/04 - Raccords dans lesquels les surfaces d'étanchéité sont maintenues en contact par un organe, p. ex. un écrou à oreilles vissé dans, ou vissé sur une des parties du raccord utilisant des segments rigides additionnels, scellés directement à une extrémité du tuyau au moins, cette extrémité étant rabattue soit avant, soit pendant l'opération d'assemblage
F16L 19/05 - Raccords dans lesquels les surfaces d'étanchéité sont maintenues en contact par un organe, p. ex. un écrou à oreilles vissé dans, ou vissé sur une des parties du raccord utilisant des segments rigides additionnels, scellés directement à une extrémité du tuyau au moins, cette extrémité étant rabattue soit avant, soit pendant l'opération d'assemblage avec un segment de poussée rigide disposé entre l'organe fileté et le côté extérieur évasé du tuyau
F16L 25/14 - Raccords pour tuyaux de diamètre ou de section transversale différents
F16L 47/04 - Raccordements ou autres accessoires de raccordement spécialement adaptés pour être en matières plastiques ou pour être utilisés avec des tuyaux en matières plastiques comprenant un écrou ou un collier rotatif s'engageant sur le tuyau
The present invention relates to a nut for a connector assembly for a tube including: an annular nut body including a polymer and oriented down a central axis, the annular nut body including: a circumferential split defining a first circumferential portion and a second circumferential portion, where the first circumferential portion and the second circumferential portion are flexibly connected by a pliable bridge portion, where the first circumferential portion includes a first circumferential end and the second circumferential portion includes a second circumferential end, where the first circumferential end and the second circumferential end each include a coupling component adapted to fix the first circumferential end and the second circumferential end together.
A tube includes a layer including a polymer matrix and a refractive index domain dispersed within the polymer matrix, wherein the refractive index domain has a refractive index less than a refractive index of the polymer matrix, the layer having a refractive index of less than 1.42.
A tube includes a layer including a polymer matrix and a refractive index domain dispersed within the polymer matrix, wherein the refractive index domain has a refractive index less than a refractive index of the polymer matrix, the layer having a refractive index of less than 1.42.
A composite film may include a first transparent substrate and a first anti-reflective coating overlying a first surface of the first transparent substrate. The first anti-reflective coating may include a first binder component and a first particulate filler component. The first particulate filler component may include hollow silica nanoparticles. The composite film may further have a VLT of at least about 94.0% and a water contact angle of at least about 70°.
C09D 5/00 - Compositions de revêtement, p. ex. peintures, vernis ou vernis-laques, caractérisées par leur nature physique ou par les effets produitsApprêts en pâte
C09D 7/61 - Adjuvants non macromoléculaires inorganiques
17 - Produits en caoutchouc ou en matières plastiques; matières à calfeutrer et à isoler
Produits et services
Fluid transfer system comprising a non-metal joint coupler that attaches two components that convey liquid together, a non-metal inbuilt type of connection that provides an internal full, double seal with its pre-formed rolled connection, and non-metal components equipped with housing body variations namely, fittings, valves, distribution bellows pumps, filters, filter housing, manifold, regulators, and flow meter for transporting fluids in microelectronic manufacturing facilities.
95.
FRICTION PAD, ASSEMBLY, AND METHOD OF MAKING AND USING THE SAME
A friction pad including a friction pad body including an annular base defining an aperture down a central axis, and first and second opposing major surfaces, where the friction pad body includes a low friction material, and where at least one of the major surfaces includes a plurality of grooves adapted to retain lubricant.
A friction pad including a friction pad body including an annular base defining an aperture down a central axis, and first and second opposing major surfaces, where the friction pad body includes a low friction material, and where at least one of the major surfaces includes a plurality of grooves adapted to retain lubricant.
F16D 7/02 - Accouplements à glissement, p. ex. glissant en cas de surcharge, pour absorber les chocs du type à friction
F16D 43/21 - Embrayages automatiques à commande interne actionnés entièrement mécaniquement commandés par le couple, p. ex. embrayages à déclenchement en cas de surcharge, embrayages à glissement avec dispositifs par lesquels le couple fait varier la pression d'embrayage avec organes à friction
F16D 69/00 - Garnitures de frictionLeur fixationEmploi pour travailler ensemble de matériaux ou de surfaces de friction spécifiées
Systems and methods include providing an annular seal stack for an assembly. The seal stack is disposed within an annulus formed between a probe and a housing of the assembly and configured to provide a radial seal between the probe and the housing. The seal stack includes a first support retainer, a first lipseal, a first seal support system comprising at least one support ring disposed between the first support retainer and the first lipseal, a second support retainer configured to support the first lipseal, a second lipseal, a second seal support system comprising at least one support ring disposed between the second support retainer and the second lipseal, and a third support retainer configured to support the second lipseal.
F16J 15/32 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques
F16J 15/3228 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre formée par déformation d’une bague plate
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
98.
ENERGIZING ELEMENT AND METHODS OF MAKING AND USING THE SAME
F16J 15/3208 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques
F16J 15/3288 - Structures filamentaires, p. ex. joints à brosse
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
99.
Energizing element and methods of making and using the same
F16J 15/32 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
A seal including: an annular jacket including a body including a first lip, and a second lip defining an annular recess, the first lip including an arcuate exterior portion, the second lip including a rectilinear exterior portion and a rectilinear, tapered edge; and an annular energizer disposed within the annular recess, adjacent to at least one of the first lip and the second lip.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
