A solventless pressure sensitive adhesive may include a silicone-based diluent component, an MQ resin component, a vinyl silicone component, and a crosslinker component. The silicone-based diluent component content may be at least about 0.1 wt.% and not greater than about 14 wt.% for a total weight of the solventless pressure sensitive adhesive, the MQ resin component content may be at least about 30 wt.% and not greater than about 65 wt.% for a total weight of the solventless pressure sensitive adhesive, the vinyl silicone component content may be at least about 27 wt.% and not greater than about 62 wt.% for a total weight of the solventless pressure sensitive adhesive, and the crosslinker component content may be at least about 0.5 wt.% and not greater than about 8.0 wt.% for a total weight of the solventless pressure sensitive adhesive.
A blender assembly including: an inner member including a bearing oriented down a central axis; an outer member including a housing disposed at least partially exterior and concentric to the inner member; and at least one snap ring disposed radially between the inner member and the outer member, the at least one snap ring including: a snap ring body including a split annular body defining an aperture oriented down the central axis, where the snap ring body includes a substrate and a polymer layer overlying the substrate.
A47J 43/07 - Éléments ou parties constitutives, p. ex. outils pour mélanger ou pour battre
A47J 43/046 - Machines de ménage non prévues ailleurs, p. ex. pour moudre, mélanger, agiter, pétrir, émulsionner, fouetter ou battre les aliments, p. ex. actionnées par moteur à outils actionnés du côté du fond
3.
CELL CULTURE ARTICLES HAVING TEXTURED SURFACES AND USES THEREOF IN THE CULTURE OF ISLET CELLS AND BETA CELLS
This disclosure relates generally to cell culture articles (e.g., in the form of bags) having textured surfaces for growth of cells, e.g., in the form of organoids or spheroids. In one aspect, the disclosure provides a cell culture article having a first polymer film as a first boundary of a cell culture internal volume, the first polymer film having a plurality of pyramidal voids extending from a pyramid base at the inner surface or the outer surface of the first polymer film, to a pyramid tip, each of the pyramidal voids having a first base lateral dimension in the range of 150-2500 microns, a first tip lateral dimension up to 100 microns, and a depth in the range of 40-1000 microns, wherein the plurality of pyramidal voids forms a plurality of cell culture wells at the inner surface of the first polymer film.
The present disclosure relates to an impeller including: a post oriented down a central axis, the post including a balancing tip region; and a rotatable element including a plurality of blades, where at least one of the post or the rotatable element comprises a magnetic member, and where the rotatable element is configured to rotate about the post while being entirely supported on the balancing tip region of the post.
A population of recycled silica particles includes: a plurality of individual silica particles, wherein the silica particles are hydrophobic. Further disclosed is a method of recycling a commercially available polymer article including: a) providing the commercially available polymer article; b) mechanically breaking the article into multiple polymer pieces, wherein the polymer includes at least one silicon-oxygen bond and a reinforcing silica filler; c) mixing a mixture including the polymer pieces, a solvent, and a catalyst, wherein the mixture provides a polymer oil and a population of recycled silica particles; and d) separating the polymer oil and the population of recycled silica particles from the mixture, wherein the population of recycled silica particles provides a plurality of individual silica particles.
A apparatus including: a silicone-based body oriented down a central axis, the silicone-based body comprising: a rigid frame having a top axial surface and a bottom axial surface, an outer surface, and a substantially arcuate inner surface; and a plurality of gas-permeable, flexible film membranes connecting the inner surface about a perimeter of the rigid frame at the top axial surface and the bottom axial surface respectively to define an internal void within the body, wherein the rigid frame has a plurality of corrugations along the top axial surface and the bottom axial surface, and wherein the internal void provides for a medically, biologically, chemically, or pharmaceutically active environment.
A61J 1/14 - Récipients spécialement adaptés à des fins médicales ou pharmaceutiques DétailsAccessoires à cet effet
A61J 1/05 - Récipients spécialement adaptés à des fins médicales ou pharmaceutiques pour recueillir, stocker ou administrer du sang, du plasma ou des liquides à usage médical
A population of recycled silica particles includes: a plurality of individual silica particles, wherein the silica particles are hydrophobic. Further disclosed is a method of recycling a commercially available polymer article including: a) providing the commercially available polymer article; b) mechanically breaking the article into multiple polymer pieces, wherein the polymer includes at least one silicon-oxygen bond and a reinforcing silica filler; c) mixing a mixture including the polymer pieces, a solvent, and a catalyst, wherein the mixture provides a polymer oil and a population of recycled silica particles; and d) separating the polymer oil and the population of recycled silica particles from the mixture, wherein the population of recycled silica particles provides a plurality of individual silica particles.
C08J 11/00 - Récupération ou traitement des résidus
C08J 11/18 - Récupération ou traitement des résidus des polymères par coupure des chaînes moléculaires des polymères ou rupture des liaisons de réticulation par voie chimique, p. ex. dévulcanisation par traitement avec une substance organique
C08J 11/08 - Récupération ou traitement des résidus des polymères sans réaction chimique utilisant des solvants sélectifs des constituants polymères
B29B 17/04 - Désintégration des matières plastiques
8.
APPARATUS, SYSTEM, AND METHOD FOR STORING MEDICAL, PHARMACEUTICAL, OR BIOLOGICAL MEDIA
An apparatus including: a core including an annular body defining an internal void oriented down a central axis having a top axial surface and a bottom axial surface; at least one retainer including an annular body adapted to couple to the top axial surface or the bottom axial surface of the core to form a circumferential engagement cavity defined radially between the at least one retainer and the core; at least one ring seal disposed within the engagement cavity; and at least one flexible film membrane partially disposed within the engagement cavity, where the at least one flexible film membrane at least partially encloses the internal void to provide for a medically, biologically, or pharmaceutically active environment within the internal void of the core.
A61J 1/05 - Récipients spécialement adaptés à des fins médicales ou pharmaceutiques pour recueillir, stocker ou administrer du sang, du plasma ou des liquides à usage médical
A61J 1/14 - Récipients spécialement adaptés à des fins médicales ou pharmaceutiques DétailsAccessoires à cet effet
The present application is directed to a filter including: a first housing member having a fluid inlet port; a second housing member positioned axially underneath the first housing member, the second housing member having a fluid outlet port; a porous filter element disposed between the first and second housing members; and a thermoplastic overmold which is molded over the periphery of the housing members sealing the periphery of the housing members together to form an internal volume housing the porous filter element, where the first housing member includes a radial sidewall comprising at least one axial step, and where the second housing member includes a substantially rectilinear radial sidewall
B01F 27/91 - Mélangeurs à agitateurs tournant dans des récipients fixesPétrins avec des agitateurs tournant autour d'un axe sensiblement vertical avec des hélices
B01F 27/072 - Agitateurs caractérisés par leur montage sur l’arbre caractérisés par la disposition des agitateurs par rapport à l'axe de rotation
B01F 27/113 - Agitateurs en forme d'hélice pour produire un écoulement axial, p. ex. en forme d'hélice de navire ou d'avion
B01F 27/1125 - Agitateurs caractérisés par la configuration des agitateurs avec des bras, des pales ou des lames avec des pales ou des lames s'étendant parallèlement ou obliquement par rapport à l'axe de l'agitateur
11.
COMPOSITE MATERIAL, COMPOSITE MATERIAL LAYER, AND THERMAL INTERFACE MATERIAL WITH THERMAL CONDUCTIVITY PROPERTIES
The subject application relates to a composite material that may include a silicone-based matrix component, and a filler package component. The filler package component may include a first thermally conductive filler component and a second thermally conductive filler component. The first thermally conductive filler component may have an average particle size of at least about 30 microns and not greater than about 150 microns, and the second thermally conductive filler component may have an average particle size of at least about 1 micron and not greater than about 10 microns. The composite material may have a thermal conductivity of at least about 1.0 W/mk and not greater than about 5.0 W/mk.
The present disclosure relates to a multilayer composite that may include a foam layer, and a multilayer topcoat component overlying the foam layer. The multilayer topcoat component may include a first topcoat layer that includes a polyether polyurethane material, and a second topcoat layer that includes a hydrophobic polyurethane material. The second topcoat layer may overly the first topcoat layer, and the multilayer composite material may have a water resistance rating of at least about 10 hours.
The subject application relates to an article and method of making. An article includes a polymer composition, the polymer composition including a silicone elastomer and a hydrogen peroxide degradation catalyst.
A fastener including: a sidewall oriented about a central axis, the sidewall including at least one of 1) at least one first type of deformable projection comprising a teardrop shaped radial face, or 2) an arcuate portion, a radial corrugation portion, and a circumferential corrugation portion, where the sidewall is a layered structure including a substrate and an insulating layer overlying the substrate.
F16B 21/07 - Dispositifs de fixation largables à action rapide dans lesquels la douille a une partie élastique
F16B 2/04 - Brides ou colliers, c.-à-d. dispositifs de fixation dont le serrage est effectué par des forces effectives autres que la résistance à la déformation inhérente au matériau dont est fait le dispositif internes, c.-à-d. agissant par expansion
15.
COMPOSITE MATERIAL, COMPOSITE MATERIAL LAYER, AND CELL VENT PROTECTION COMPOSITE WITH THERMAL BARRIER PROPERTIES
The subject application relates to composite material, composite material layer, and cell vent protection composite with thermal barrier properties. The subject application relates to a composite material that may include a silicone-based matrix component, a reinforcing filler component distributed within the silicone-based matrix component, and a ceramization filler composition distributed within the silicone-based matrix component. The ceramization filler composition may include a ceramization filler component, a structure promoter component, a flux component, and a flame retardant component.
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
C08J 9/06 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent chimique de gonflage
C08J 9/10 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent chimique de gonflage dégageant de l'azote
16.
COMPOSITE MATERIAL, COMPOSITE MATERIAL LAYER, AND THERMAL BARRIER COMPOSITE WITH THERMAL BARRIER PROPERTIES
The subject application relates to composite material, composite material layer, and thermal barrier composite with thermal barrier properties. The subject application relates to a composite material that may include a silicone-based matrix component, a reinforcing filler component distributed within the silicone-based matrix component, and a ceramization filler composition distributed within the silicone-based matrix component. The ceramization filler composition may include a ceramization filler component, a structure promoter component, a flux component, and a flame retardant component.
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
C08J 9/06 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent chimique de gonflage
C08J 9/10 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent chimique de gonflage dégageant de l'azote
A tube including: at least one inner fluoropolymer layer, where the at least one inner fluoropolymer layer includes a first fluoropolymer having a melting temperature of about 140°C to 200°C, and at least one outer fluoropolymer layer overlying the inner fluoropolymer layer, the at least one outer fluoropolymer layer having an inner surface and an outer surface where the outer fluoropolymer layer includes a second fluoropolymer having a heat shrink temperature of less than 250°C, where the tube has a working temperature up to 180°C, where the at least one outer fluoropolymer layer has a shrink ratio of at least 1.5:1 along the inner surface of the at least one outer fluoropolymer layer.
B29C 48/09 - Objets dont la section transversale comporte des cavités partiellement ou entièrement fermées, p. ex. tuyaux ou canaux
B29C 48/16 - Articles comprenant au moins deux composants, p. ex. couches coextrudées
B29C 48/15 - Moulage par extrusion, c.-à-d. en exprimant la matière à mouler dans une matrice ou une filière qui lui donne la forme désiréeAppareils à cet effet incorporant des éléments ou des couches préformés, p. ex. moulage par extrusion autour d’inserts
The present disclosure relates to an aerogel-based layer may include a silicone-based binder component at a content of at least about 10 wt.% and not greater than about 90 wt.% for a total weight of the aerogel-based layer, and an aerogel component at a content of at least about 10 wt.% and not greater than about 90 wt.% for a total weight of the aerogel-based layer.
The present disclosure relates to a pressure sensitive adhesive may include a polyisobutylene-based material, and a peroxide based additive. The pressure sensitive adhesive may have an Adhesive Electrolyte Exposure Peel Force (AEEPF) of at least about 0.5 N/cm.
A pressure sensitive adhesive composite material may include a pressure sensitive adhesive layer that may include a pressure sensitive adhesive material, and a scrim layer that may include a grid of fibers. The scrim layer may be encased within the pressure sensitive adhesive layer. The pressure sensitive adhesive composite material may include a grid region of the fibers coated with the pressure sensitive adhesive material, and a plurality of window regions of the pressure sensitive adhesive material between the fibers. An average thickness of the plurality of widow regions is less than an average thickness of the grid region.
The present disclosure relates to a multilayer gasket that may include a core layer, and a first outer layer overlying a first surface of the core layer. The first outer layer may include a low-melt fluoropolymer material having a melting temperature of not greater than about 300 ˚C.
A rotary shaft seal including an annular body having an aperture defining a central axis and an inner surface; a shaft disposed within the aperture of the annular body; and a sealing element positioned at least partially between the shaft and the annular body, where the sealing element is configured to form a seal between the annular body and the shaft, where the sealing element includes a body having a U-shaped or a V-shaped cross-section including a plurality of lips, where at least one lip of the sealing element is fixed to at least one of the shaft or the annular body, and where a cavity exists between at least one of the plurality of lips and at least one of the shaft or the annular body.
F16J 15/3204 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
A peristaltic pump tube (100) includes a silicone composition including a base silicone material, an accelerator, a curing agent, and a catalyst, wherein the base silicone material includes a blend of a first silicone elastomer and a second silicone elastomer, wherein the first silicone elastomer has a shore A durometer that is different than a shore A durometer of the second silicone elastomer; wherein the peristaltic pump tube (100) is used with a peristaltic pump at rotator speeds of greater than 600 rotations per minute, and the silicone composition advantageously increases pump life of the peristaltic pump tube (100).
The present disclosure relates to a multilayer composite or multilayer laminate that may include a core foam layer, and a first ceramifiable barrier component contacting the core foam layer. The ceramifiable barrier component may include a ceramifiable layer. The multilayer composite may have a HBF flammability rating as measured according to ASTM D4986.
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
B32B 27/28 - Produits stratifiés composés essentiellement de résine synthétique comprenant des copolymères de résines synthétiques non complètement couverts par les sous-groupes suivants
26.
RETENTION SYSTEMS FOR SLIDING MEMBERS FOR USE IN LINEAR MOTION ASSEMBLIES
A linear motion assembly including: a first component; a second component; and a sliding member disposed between the first and second components; and a retention system adapted to retain the sliding member between the first component and the second component, where the retention system includes a retention frame and at least one spring element, where the sliding member is disposed between the retention frame and the spring element, where the spring element provides a biasing force on the sliding member.
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3248 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques pourvus d’armatures ou de supports
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
A seal including: a metal annular body oriented down a central axis, the metal annular body comprising an axially elongated heel flange, a first lip, and a second lip defining an annular recess that bisects the central axis, wherein a radial midpoint of the axially elongated heel flange is radially offset from the central axis, a radial midpoint of the first lip, and a radial midpoint of the second lip.
F16J 15/34 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par bague glissante pressée contre la face plus ou moins radiale d'une des deux parties
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
29.
MULTILAYER LAMINATE STRUCTURE AND METHOD OF FORMING THE SAME
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an encapsulant layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The encapsulant layer comprises an encapsulant component and a first encapsulant layer ultra violet (UV) absorber component.
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
C09K 3/10 - Substances non couvertes ailleurs pour sceller ou étouper des joints ou des couvercles
H10K 77/10 - Substrats, p. ex. substrats flexibles
The subject application relates to a filler composition, composite material and composite material layer with thermal barrier properties. The present disclosure relates to a filler composition may include a ceramization filler component at a content of at least about 50 wt.% and not greater than about 90 wt.% for a total weight of the filler composition, a reinforcement component at a content of at least about 0.1 wt.% and not greater than about 10.0 wt.% for a total weight of the filler composition, a flux component at a content of at least about 3.0 wt.% and not greater than about 10.0 wt.% for a total weight of the filler composition, and a flame retardant component at least about 5.0 wt.% and not greater than about 20.0 wt.% for a total weight of the filler composition.
The subject application relates to a filler composition, composite material and composite material layer with thermal barrier properties. The present disclosure relates to a filler composition may include a ceramization filler component at a content of at least about 75 wt.% and not greater than about 95 wt.% for a total weight of the filler composition, a structure promoter component at a content of at least about 0.1 wt.% and not greater than about 7.0 wt.% for a total weight of the filler composition, a flux component at a content of at least about 0.1 wt.% and not greater than about 7.0 wt.% for a total weight of the filler composition, and a flame retardant component at least about 5.0 wt.% and not greater than about 20.0 wt.% for a total weight of the filler composition.
The disclosure relates to coated surfaces suitable for cell culture, to methods for making such surfaces, and to methods for culturing adherent cells on such surfaces. One aspect of the disclosure is a surface suitable for cell culture including an amorphous hydrogenated carbon coating. Another aspect of the disclosure is a method for making a surface suitable for cell culture including an amorphous hydrogenated carbon coating. Another aspect of the disclosure is a method for culturing adherent cells that includes incubating a surface including an amorphous hydrogenated carbon coating with adherent cells and a growth medium.
This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).
The present disclosure related to a silicone-based foam may include a component A and a component B, where the component A may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, and a third filler component that may include calcium carbonate, and where the component B may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, a third filler component that may include calcium carbonate, and a fourth filler component that may include zinc borate. The silicone-based foam may have a V-0 flammability rating as measured according to ASTM D3801.
The present disclosure related to a multilayer composite that may include a first polymethylpentene (TPX) liner, and a silicone-based foam layer overlying the first TPX liner. The silicone-based foam layer may include a component A and a component B, where the component A may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, and a third filler component that may include calcium carbonate, and where the component B may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, a third filler component that may include calcium carbonate, and a fourth filler component that may include zinc borate. The silicone-based foam layer may have a V-0 flammability rating as measured according to ASTM D3801.
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
C08J 9/00 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement
C08J 9/14 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent physique de gonflage organique
Embodiments described herein are generally directed to an annular seal including: an annular body defining a cross-section down a central axis, the annular body including: a first linear section oriented down a first plane; a first portion contiguous with the first end of the first linear section, the first portion being curved with respect to the first linear section and in accordance with a first predetermined radius, the first portion extending to a first distal end; a second portion contiguous with the second end of the first linear section, the second portion including: a second linear section oriented down a second plane non-parallel to the first plane; and at least one discrete, radially-oriented tab contiguous with the second linear section and oriented along a circumference of the annular body.
F16J 15/10 - Joints d'étanchéité entre surfaces immobiles entre elles avec garniture solide comprimée entre les surfaces à joindre par garniture non métallique
F16J 15/08 - Joints d'étanchéité entre surfaces immobiles entre elles avec garniture solide comprimée entre les surfaces à joindre exclusivement par garniture métallique
The present invention relates to a nut for a connector assembly for a tube including: an annular nut body including a polymer and oriented down a central axis, the annular nut body including: a circumferential split defining a first circumferential portion and a second circumferential portion, where the first circumferential portion and the second circumferential portion are flexibly connected by a pliable bridge portion, where the first circumferential portion includes a first circumferential end and the second circumferential portion includes a second circumferential end, where the first circumferential end and the second circumferential end each include a coupling component adapted to fix the first circumferential end and the second circumferential end together.
F16L 19/04 - Raccords dans lesquels les surfaces d'étanchéité sont maintenues en contact par un organe, p. ex. un écrou à oreilles vissé dans, ou vissé sur une des parties du raccord utilisant des segments rigides additionnels, scellés directement à une extrémité du tuyau au moins, cette extrémité étant rabattue soit avant, soit pendant l'opération d'assemblage
F16L 19/05 - Raccords dans lesquels les surfaces d'étanchéité sont maintenues en contact par un organe, p. ex. un écrou à oreilles vissé dans, ou vissé sur une des parties du raccord utilisant des segments rigides additionnels, scellés directement à une extrémité du tuyau au moins, cette extrémité étant rabattue soit avant, soit pendant l'opération d'assemblage avec un segment de poussée rigide disposé entre l'organe fileté et le côté extérieur évasé du tuyau
F16L 25/14 - Raccords pour tuyaux de diamètre ou de section transversale différents
F16L 47/04 - Raccordements ou autres accessoires de raccordement spécialement adaptés pour être en matières plastiques ou pour être utilisés avec des tuyaux en matières plastiques comprenant un écrou ou un collier rotatif s'engageant sur le tuyau
A tube includes a layer including a polymer matrix and a refractive index domain dispersed within the polymer matrix, wherein the refractive index domain has a refractive index less than a refractive index of the polymer matrix, the layer having a refractive index of less than 1.42.
A friction pad including a friction pad body including an annular base defining an aperture down a central axis, and first and second opposing major surfaces, where the friction pad body includes a low friction material, and where at least one of the major surfaces includes a plurality of grooves adapted to retain lubricant.
F16D 7/02 - Accouplements à glissement, p. ex. glissant en cas de surcharge, pour absorber les chocs du type à friction
F16D 43/21 - Embrayages automatiques à commande interne actionnés entièrement mécaniquement commandés par le couple, p. ex. embrayages à déclenchement en cas de surcharge, embrayages à glissement avec dispositifs par lesquels le couple fait varier la pression d'embrayage avec organes à friction
F16D 69/00 - Garnitures de frictionLeur fixationEmploi pour travailler ensemble de matériaux ou de surfaces de friction spécifiées
40.
ENERGIZING ELEMENT AND METHODS OF MAKING AND USING THE SAME
F16J 15/3208 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques
F16J 15/3288 - Structures filamentaires, p. ex. joints à brosse
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
A seal including: an annular jacket including a body including a first lip, and a second lip defining an annular recess, the first lip including an arcuate exterior portion, the second lip including a rectilinear exterior portion and a rectilinear, tapered edge; and an annular energizer disposed within the annular recess, adjacent to at least one of the first lip and the second lip.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
42.
TORQUE PERFORMANCE BEARINGS AND METHODS OF MAKING AND USING THE SAME
A bearing (400) including: a sidewall (402) including a substrate (1119) and a low friction layer (1104) overlying the substrate, where the sidewall further includes: an unformed section (440); at least one slot (442) in the unformed section; and at least one protrusion (450) extending from the unformed section forming a generally concave or convex cross-sectional shape in the sidewall.
The subject application relates to polyurethane foam and methods of forming the same. A polyurethane foam may include a polyurethane foam may include a first polyol component, a second polyol component, and a third polyol component. The first polyol component may include at least one component selected from the group of a polyether polyol and a polyester polyol. The second polyol component may include a polyether polyol. The third polyol component may include a grafted polyether polyol. The polyurethane foam may have a density of at least about 100 kg/m3and not greater than about 800 kg/m3. The polyurethane foam may have an adjusted compression force deflection to density ratio of at least about 0.3.
A seal including a jacket including an annular body defining a central axis and a recess extending into the annular body concentric to the central axis, where the jacket includes at least 30 wt% of a PTFE and at least 10 wt% of a filler material, and where the filler material includes a boron-containing material, a nitrogen-containing material, a titanium-containing material, a silicon-containing material, a carbon fiber, a glass fiber, or a combination thereof; and an energizing element disposed in the recess, where the energizing element includes a gap-less spring.
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
B32B 27/36 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyesters
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
B32B 7/06 - Liaison entre couches permettant une séparation sans difficultés
B32B 37/26 - Procédés ou dispositifs pour la stratification, p. ex. par polymérisation ou par liaison à l'aide d'ultrasons caractérisés par les propriétés des couches avec au moins une couche influençant la liaison au cours de la stratification, p. ex. couches anti-adhésives ou couches égalisatrices de la pression
46.
MULTILAYER LAMINATE STRUCTURE AND METHOD OF FORMING THE SAME
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an adhesive layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The adhesive layer comprises an adhesive component and a first adhesive layer ultra violet (UV) absorber component. The multilayer laminate structure may have a lower ultra-violet light transmission (L-UVLT) of not greater than 1.0%, a high ultra-violet light transmission (H-UVLT) of not greater than 5.0%, and a visual light transmission (VLT) of at least about 50.0%.
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
The present disclosure relates to a multilayer film may include a fluoropolymer based layer that may include a fluoropolymer based material, and an adhesive layer in contact with the fluoropolymer based layer. The adhesive layer may include a first ultra-violet (UV) absorber component. The multilayer film may have a lower ultra-violet light transmission (L-UVLT) of not greater than 1.0%, where the L-UVLT of the multilayer film is defined as the percent transmission between 200 nm and 360 nm. The multilayer film may further have a high ultra-violet light transmission (H-UVLT) of not greater than 5.0%, where the H-UVLT of the multilayer film is defined as the percent transmission between 360 nm and 380 nm. The multilayer film may include a visual light transmission (VLT) of at least about 50.0%, where the VLT of the multilayer film is defined as the percent transmission between 400 nm and 1100 nm.
C09J 7/24 - Matières plastiquesMatières plastiques métallisées à base de composés macromoléculaires obtenus par des réactions faisant intervenir uniquement des liaisons non saturées carbone-carbone
C09J 7/30 - Adhésifs sous forme de films ou de pellicules caractérisés par la composition de l’adhésif
48.
MULTILAYER LAMINATE STRUCTURE AND METHOD OF FORMING THE SAME
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an adhesive layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The fluoropolymer based layer may include a fluoropolymer based material and a first fluoropolymer based layer ultra-violet (UV) component. The multilayer laminate structure may have a lower ultra-violet light transmission (L-UVLT) of not greater than 1.0%, a high ultra-violet light transmission (H-UVLT) of not greater than 5.0%, and a visual light transmission (VLT) of at least about 50.0%.
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
A bearing including a sidewall including an electrically conductive substrate, and an electrically non-conductive or low-conductive sliding layer coupled to the substrate, where the sidewall includes at least one circumferential rib feature protruding radially inward or radially outward from a bore defining a central axis, where the at least one circumferential rib feature has an aspect ratio between a circumferential length and an axial width of at least 2:1, where the circumferential rib feature is adapted to contact an opposing component such that at a point of contact the bearing has a void area free of sliding layer so as to provide electrical conductivity between the bearing and the opposing component.
The present disclosure relates a multilayered film may include a first PET substrate, and a first anti-fog/anti-microbial (AFAM) coating overlying the first PET substrate. The first AFAM coating may include an acrylate-based component, a silver-based filler component within the acrylate-based component, and a photo initiator component. The first AFAM coating may have a water contact angle of not greater than about 55˚. The first AFAM coating may have a MRSA anti-microbial rating of at least about 75%, where the MRSA anti-microbial rating is defined as the percent reduction of methicillin-resistant Staphylococcus aureus (MRSA) activity from an initial inoculation of MRSA on the surface of the anti-microbial layer after 24 hours as measured using ISO22196.
C08J 7/054 - Formation de revêtements anti-buée ou anti-gouttes
C09D 4/00 - Compositions de revêtement, p. ex. peintures, vernis ou vernis-laques, à base de composés non macromoléculaires organiques ayant au moins une liaison non saturée carbone-carbone polymérisable
C09D 5/14 - Peintures contenant des biocides, p. ex. fongicides, insecticides ou pesticides
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
The present disclosure relates to a pressure sensitive adhesive may include a silicone based pressure sensitive adhesive component, and an iron oxide filler mixture. The content of the iron oxide filler mixture may be at least about 0.5 wt.% and not greater than about 10.0 wt.% for a total weight of the pressure sensitive adhesive. The pressure sensitive adhesive may have a peel adhesion of at least about 600 g/in when measured at 25 ˚C, and the pressure sensitive adhesive may further have a UL 94 rating of VTM-0, a UL 94 rating of V-0, or a UL 94 rating of both VTM-0 and V-0when attached to a backing material.
A polymer composition including a fluoropolymer composition including greater than 99 wt% polytetrafluoroethylene, where the fluoropolymer composition exhibits a melting temperature of greater than 327˚C at a pressure of 0.1 MPa.
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
An article including at least one polymer, the at least one polymer including a silicone elastomer, wherein the article has an outer surface treated to provide at least silicon moieties, silicon-oxide moieties, silica-like moieties, organosilicon moieties, hydroxyl moieties, hydrocarbon moieties, or combination thereof, wherein the outer surface has a tack decrease of at least 75% compared to a non-treated outer surface.
A seal including: an annular jacket including a heel, a first lip, and a second lip defining an annular recess; and an insert including at least 3 prongs disposed within the annular recess contacting the heel, the first lip, and the second lip.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
57.
SLIDING MATERIAL, BEARING, AND METHODS OF MAKING AND USING THE SAME
A sliding material including: a substrate, and a textured sliding layer overlying the substrate, where the sliding layer includes asperities including a plurality of apexes and nadirs, where 1) the sliding layer has a root mean square gradient of less than 0.064; 2) the sliding layer has an apex material portion of less than 10%; 3) the sliding layer has a nadir material portion of less than 75%, and where the textured sliding layer induces formation of a film when engaged in a rotational interface w/ another component.
A seal including a jacket including an annular body defining a central axis and a recess extending into the annular body concentric to the central axis, where the jacket includes at least 30 wt% of a PTFE and at least 10 wt% of a filler material, and where the filler material includes a boron-containing material, a nitrogen-containing material, a titanium-containing material, a silicon-containing material, a carbon fiber, a glass fiber, or a combination thereof, where the jacket further includes a coating; and an energizing element disposed in the recess.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
A seal including: an annular jacket including a body including a first lip and a second lip defining an annular recess; an axially oriented spring disposed within the annular recess adjacent to one of the first lip and the second lip; where a radial biasing force on the first lip is decoupled from a radial biasing force on the second lip.
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
A seal including: an annular jacket including a body including a first lip and a second lip defining an annular recess; a circumferential spring disposed within the annular recess adjacent to one of the first lip and the second lip; and a floating circumferential insert, where a radial biasing force on the first lip is decoupled from a radial biasing force on the second lip.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
62.
MAGNETIC MULTILAYER COMPOSITE AND A METHOD OF FORMING THE SAME
MSMSS is the total volume of substrate. The composite may further include a permeability rating (X, Y), where the permeability rating (X, Y) is equal to a peak point (X, Y) along a plot of the imaginary part of magnetic permeability (µ'') of the composite plotted as a function of frequency, where X is within the range of 10 MHz to 10 GHz, and Y is greater than 100.
A multilayer tube includes: an inner layer including a polymer, wherein the polymer includes a fluoropolymer, a polyolefin, a blend thereof, or combination thereof; and an outer layer adjacent to the inner layer, wherein the outer layer includes a polymer including a fluoropolymer, a polyolefin, a blend thereof, or combination thereof; wherein the inner layer, the outer layer, or combination thereof includes at least one blocking agent, wherein the at least one blocking agent reduces the percent transmission by at least 99% at wavelengths between 240 nm to 450 nm.
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
B32B 27/18 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers
The present disclosure relates to a multilayer composite that may include a first barrier layer and a first foam layer. The first foam layer may include a polyurethane-based matrix component, and a flame retardant filler component. The multilayer component may also have a HBF flammability rating as measured according to ASTM D4986.
B32B 5/24 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par la présence de plusieurs couches qui comportent des fibres, filaments, grains ou poudre, ou qui sont sous forme de mousse ou essentiellement poreuses une des couches étant fibreuse ou filamenteuse
B32B 5/02 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par les caractéristiques de structure d'une couche comprenant des fibres ou des filaments
B32B 18/00 - Produits stratifiés composés essentiellement de céramiques, p. ex. de produits réfractaires
B32B 17/02 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire sous forme de fibres ou filaments
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 27/12 - Produits stratifiés composés essentiellement de résine synthétique adjacente à une couche fibreuse ou filamenteuse
B32B 27/40 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyuréthanes
B32B 27/18 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers
Systems and methods include providing a variable stator vane assembly with a stator vane bushing disposed in a housing of the variable stator vane assembly and annularly about the stator vane of the stator vane assembly. One or more tolerance rings are disposed between the housing and the bushing to maintain alignment between the between the stator vane and the bushing, the housing and the bushing, or a combination thereof when the variable stator vane assembly is operated at elevated temperatures.
Systems and methods include providing a stator vane bushing for a variable stator vane assembly having a movable stator vane and a stator vane housing disposed annularly about the movable stator vane. The bushing includes a flange, a barrel extending from the flange, and a central aperture extending through the flange and the barrel and is disposed in the housing and annularly about the stator vane. The bushing is formed from a ceramic material having a coefficient of thermal expansion (CTE) lower than or equal to a CTE of one or more of a stator vane and a housing of the variable stator vane assembly.
The present disclosure relates to an unassembled multilayer mechanical belt may include a first angled step-joint tab, a second angled step-joint tab, and a central overlap region between the first angled step-joint tab and the second angled step-joint tab. The central overlap region may include a first mechanical belt material layer overlying and adhered to a second mechanical belt material. The first angled step-joint tab may include a first tab backing material and a first tab adhesive material. The second angled step-joint tab may include a second tab backing material and a second tab adhesive material. The first angled step-joint tab may be configured to overlap with and adhere to the second angled step-joint tab to create a splice joint region of an assembled multilayer mechanical belt.
The present disclosure relates to a foam layer that may include a silicone based matrix component, a flame retardant filler component, and an insulation filler component. The foam layer may have a thickness of at least about 0.5 mm and no greater than about 10 mm. The foam layer may further have a compression force deflection at 25% of at least about 5 kPa and not greater than about 500 kPa. The foam layer may also have a HBF flammability rating as measured according to ASTM D4986.
The present disclosure relates to a multilayer composite that may include a multilayer composite that may include a first barrier layer and a first foam layer. The first foam layer may include a silicone-based matrix component, a flame retardant filler component, and an insulation filler component. The multilayer component may have a thickness of at least about 0.5 mm and no greater than about 10 mm. The multilayer component may also have a HBF flammability rating as measured according to ASTM D4986.
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 27/28 - Produits stratifiés composés essentiellement de résine synthétique comprenant des copolymères de résines synthétiques non complètement couverts par les sous-groupes suivants
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
The present disclosure relates to a composite article that may include a structural substrate, a multilayer fluoropolymer film that can include a high-melt fluoropolymer layer and a low-melt fluoropolymer adhesion layer that may contact the structural substrate and the fluoropolymer film. The high-melt fluoropolymer layer may have a melting temperature A1 and the low-melt fluoropolymer adhesive layer may have a melting temperature A2. The melting temperature A2 may be less than the melting temperature A1.
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
B32B 7/08 - Liaison entre couches par des moyens mécaniques
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
B32B 27/30 - Produits stratifiés composés essentiellement de résine synthétique comprenant une résine vinyliqueProduits stratifiés composés essentiellement de résine synthétique comprenant une résine acrylique
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
A composite tube includes a first layer including a cross-linked polyolefin elastomer, wherein the first layer is configured for fluid contact; and a second layer adjacent to the first layer, the second layer including an elastomer.
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
B32B 27/26 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des durcisseurs
Systems and methods include providing a seal for an assembly. The seal includes a jacket having a base, an inner sealing leg, and an outer sealing leg, and further includes a spring disposed within the jacket between and in contact with the inner sealing leg and the outer sealing leg. The spring includes a metallic annular body comprising an inner diameter and an outer diameter, and a plurality of radially cut perforations disposed about at least one of the inner diameter and the outer diameter of the metallic annular body.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
73.
BEARING ASSEMBLY FOR TRACKER ASSEMBLY AND METHODS OF MAKING AND USING THE SAME
A bearing assembly of a power generation structure including, a rail; and a housing adapted to support the rail; where the housing includes a fixed housing portion attached to a support beam, and an adjustable housing portion attached to rail, where a low friction material is present at an interface between an exterior surface of rail and an interior surface of the adjustable housing portion, where the adjustable housing portion is capable of self-aligning adjustment of at least a portion of the rail out of alignment with a central axis of the support beam.
The present application is directed to a multi-layered material, including a first layer having a first composition comprising a polyolefin, fluoropolymer, or copolymer thereof, where the first layer has a first VHP permeability; and a second layer including a second composition including polyamide, polyimide, polyurethane, polyester, siloxane, or copolymer thereof, where the second layer has a second VHP permeability, where the multi-layered material includes a third VHP permeability of less than 10% of the first VHP permeability or the second VHP permeability.
B32B 3/04 - Caractérisés par des caractéristiques de forme en des endroits déterminés, p. ex. au voisinage des bords caractérisés par une couche pliée au bord, p. ex. par-dessus une autre couche
B32B 27/28 - Produits stratifiés composés essentiellement de résine synthétique comprenant des copolymères de résines synthétiques non complètement couverts par les sous-groupes suivants
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
B32B 27/30 - Produits stratifiés composés essentiellement de résine synthétique comprenant une résine vinyliqueProduits stratifiés composés essentiellement de résine synthétique comprenant une résine acrylique
Systems and methods are disclosed that include providing a filter assembly having a filter housing and a filter medium disposed within and/or carried by the filter housing. The filter medium is configured to be exposed to an external environment and collect, filter, or otherwise remove aerosols (which may be contaminated with bacteria, viruses, or a combination thereof) from the external environment when coupled to an evacuation component, such as a dental high vacuum evacuation (HVE) line.
A61M 1/00 - Dispositifs de succion ou de pompage à usage médicalDispositifs pour retirer, traiter ou transporter les liquides du corpsSystèmes de drainage
A61C 17/06 - Appareils pour enlever la saliveLeurs accessoires
NNNNN, determining a Combination Incidence Angle Distribution (Combo-Iα-Dist) corresponding the Combo-Lα-Dist, and tailoring at least one radome shell structural component of the radome to minimize electromagnetic degradation of electromagnetic waves intersecting the radome at angles within the Combo-Iα-Dist.
A tube includes at least one fluoropolymer layer, the tube having an inner surface and an outer surface, wherein the at least one fluoropolymer layer includes a fluoropolymer having a heat shrink temperature of less than 250°C, wherein the outer surface of the tube is crosslinked and the inner surface of the tube is not crosslinked.
The disclosure relates generally to a cell culture apparatus and a cell culture method. One aspect of the disclosure is an oxygen-permeable bag comprising one or more polymer films defining a boundary of an interior compartment of the bag, each of the one or more polymer films comprising an inner layer adjacent the inferior compartment of the bag, the inner layer comprising a fiuoropolymer, and adhered to the inner layer, an outer layer comprising polymer; a first port formed in an exterior surface of the bag and in fluid communication with the interior compartment; a second port formed in an exterior surface of the bag and in fluid communication with the interior compartment; and contained in the interior compartment, a plurality of microcarriers.
The present disclosure relates to an antimicrobial thin film layer that may include a metallic material. The antimicrobial thin film layer may have a VLT of at least about 60%. The antimicrobial thin film layer may further have a MRSA anti-microbial rating of at least about 75%, where the MRSA anti-microbial rating is defined as the percent reduction of methicillin-resistant Staphylococcus aureus (MRSA) activity from an initial inoculation of MRSA on the surface of the anti-microbial layer after 24 hours as measured using ISO22196.
C03C 17/06 - Traitement de surface du verre, p. ex. du verre dévitrifié, autre que sous forme de fibres ou de filaments, par revêtement par des métaux
B32B 15/08 - Produits stratifiés composés essentiellement de métal comprenant un métal comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
B32B 17/06 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique
80.
PACKAGING CONTAINER AND METHOD OF MAKING AND USING THE SAME
The present application is directed to a packaging container including a body including; a first portion including a coupling feature; a second portion including a coupling feature and complementary to the first portion; and a hinge portion coupling the first portion to the second portion adapted to move the packaging container from an open position to a closed position around a product, where the first portion and the second portion combine to form a void port in the closed position.
B65D 75/32 - Objets ou matériaux enveloppés entre deux feuilles ou flans opposés à bords réunis, p. ex. par adhésifs à pression, pliage, thermosoudage ou soudage une ou les deux feuilles ou flans étant renfoncés pour épouser la forme du contenu
B65D 75/52 - Paquets comportant des objets ou matériaux partiellement ou complètement enfermés dans des bandelettes, des feuilles, des flans, des tubes ou des bandes en matériau souple mince, p. ex. dans des enveloppes pliées Détails
B65D 77/00 - Paquets réalisés en enfermant des objets ou des matériaux dans des réceptacles préformés, p. ex. des boîtes, des cartons, des sacs ou des sachets
Systems and methods are disclosed that include providing a valve suitable for maintaining a seal and preventing fluid flow through the valve at cryogenic temperatures. The valve includes a valve body having a longitudinal axis along a flow path through the valve, a ball selectively rotatable within the valve body to selectively allow fluid flow through the valve, a seat insert cavity formed within the valve body, and a seat insert assembly at least partially disposed within the seat insert cavity. The seat insert assembly includes a seat insert comprising at least one sealing lip and a support ring engaged with the at least one sealing lip and configured to bias the at least one sealing lip against a portion of the seat insert cavity to prevent leakage through a second leakage path when the ball valve is selectively rotated to prevent fluid flow through the valve.
F16K 5/06 - Robinets à boisseau consistant seulement en un dispositif obturateur dont au moins une des faces d'obturation a la forme d'une surface de solide de révolution plus ou moins complète, le mouvement d'ouverture et de fermeture étant essentiellement rotatif dont les boisseaux sont à surface sphériqueLeurs garnitures d'étanchéité
F16K 5/20 - Dispositions particulières pour tenir écartées les faces d'obturation ou pour les presser l'une contre l'autre dans le cas des boisseaux à surface sphérique
82.
DIELECTRIC SUBSTRATE AND METHOD OF FORMING THE SAME
The present disclosure relates to a copper-clad laminate that may include a copper foil layer, a fluoropolymer based adhesive layer overlying the copper foil layer, and a dielectric coating overlying the fluoropolymer based adhesive layer. The dielectric coating may include a resin matrix component, and a ceramic filler component. The ceramic filler component may include a first filler material. The dielectric coating may have an average thickness of not greater than about 20 microns.
H05K 1/09 - Emploi de matériaux pour réaliser le parcours métallique
H05K 1/03 - Emploi de matériaux pour réaliser le substrat
B32B 15/08 - Produits stratifiés composés essentiellement de métal comprenant un métal comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
B32B 15/20 - Produits stratifiés composés essentiellement de métal comportant de l'aluminium ou du cuivre
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
C09J 201/04 - Adhésifs à base de composés macromoléculaires non spécifiés caractérisés par la présence de groupes déterminés contenant des atomes d'halogène
Systems and methods are disclosed that include providing a tubing construction with at least one layer formed from a thermoplastic vulcanizate (TPV). The tubing construction is suitable for use in pump applications subjected to cyclic loading and unloading. The tubing construction maintains a flowrate stability of +/-10% for an extended period of time to provide consistent fluid dispensing and/or dosing for an extended life of the tubing construction and/or the fluid pump.
B32B 25/04 - Produits stratifiés composés essentiellement de caoutchouc naturel ou synthétique comprenant du caoutchouc comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 25/14 - Produits stratifiés composés essentiellement de caoutchouc naturel ou synthétique comprenant des copolymères dans lesquels les composants en caoutchouc prédominent
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
85.
DIELECTRIC SUBSTRATE AND METHOD OF FORMING THE SAME
The present disclosure relates to a dielectric substrate that may include a first fluoropolymer based adhesive layer, a polyimide layer overlying the fluoropolymer based adhesive layer, and a first filled polymer layer overlying the polyimide layer. The first filled polymer layer may include a resin matrix component, and a first ceramic filler component. The first ceramic filler component may include a first filler material. The first filler material may further have a mean particle size of at not greater than about 10 microns.
The present disclosure relates to a low friction roller liner for a printer assembly may include a low friction layer. The low friction layer may include a first fluoropolymer matrix component and a first thermoplastic filler component distributed throughout the first fluoropolymer matrix component. The content of the first fluoropolymer matrix component may be at least about 1 wt.% and not greater than about 99 wt.% for a total weight of the first low friction layer. The content of the first thermoplastic filler component may be at least about 1 wt.% and not greater than about 99 wt.% for a total weight of the first low friction layer.
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
B32B 27/28 - Produits stratifiés composés essentiellement de résine synthétique comprenant des copolymères de résines synthétiques non complètement couverts par les sous-groupes suivants
B32B 27/30 - Produits stratifiés composés essentiellement de résine synthétique comprenant une résine vinyliqueProduits stratifiés composés essentiellement de résine synthétique comprenant une résine acrylique
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
A polyurethane foam may include a first polyol component, a second polyol component, and a third polyol component. The first polyol component may include a polyol having an OH number of at least about 35 KOH mg/g and not greater than about 70 KOH mg/g, the second polyol component may include a polyol having an OH number of at least about 100 KOH mg/g and not greater than about 180 KOH mg/g, and the third polyol component may include a polyol having an OH number of at least about 300 KOH mg/g and not greater than about 350 KOH mg/g. The polyurethane foam may have a glass transition temperature of at least about -10 ˚C and not greater than about 35 ˚C.
C08G 18/10 - Procédés mettant en œuvre un prépolymère impliquant la réaction d'isocyanates ou d'isothiocyanates avec des composés contenant des hydrogènes actifs, dans une première étape réactionnelle
A composite film may include a first transparent substrate and a first anti-reflective coating overlying a first surface of the first transparent substrate. The first anti-reflective coating may include a first binder component and a first particulate filler component. The first particulate filler component may include hollow silica nanoparticles. The composite film may further have a VLT of at least about 94.0% and a water contact angle of at least about 70˚.
C09D 5/00 - Compositions de revêtement, p. ex. peintures, vernis ou vernis-laques, caractérisées par leur nature physique ou par les effets produitsApprêts en pâte
The present disclosure relates to a low friction bearing liner for a solenoid may include a low friction layer. The low friction layer may include a first fluoropolymer matrix component and a first thermoplastic filler component distributed throughout the first fluoropolymer matrix component. The content of the first fluoropolymer matrix component may be at least about 1 wt.% and not greater than about 99 wt.% for a total weight of the first low friction layer. The content of the first thermoplastic filler component may be at least about 1 wt.% and not greater than about 99 wt.% for a total weight of the first low friction layer.
A tube includes a layer including a fluoropolymer having a refractive index of less than 1.42, wherein the fluoropolymer includes a copolymer including vinylidene fluoride and polymethyl methacrylate, a crosslinked terpolymer including tetrafluoroethylene, hexafluoropropylene, vinylidene fluoride, or combination thereof.
Systems and methods include providing an annular seal stack for an assembly. The seal stack assembly includes, at least one second annular seal, a spacer disposed axially adjacent to the at least one second annular seal, and a third annular seal disposed axially adjacent to the spacer. The seal stack assembly is disposed between a probe and a housing of the assembly and configured to provide an annular seal between the probe and the housing during operation of the assembly at cryogenic temperatures, during exposure of at least a portion of the seal stack assembly to cryogenic temperatures, during a change in pressure, during a change in temperature, or a combination thereof.
F16J 15/34 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par bague glissante pressée contre la face plus ou moins radiale d'une des deux parties
F16J 15/3204 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre
93.
COMPOSITE ARTICLE INCLUDING AMORPHOUS CARBON COATING
A composite article including a substrate, having a first major surface, a second major surface; and an amorphous carbon coating overlying the first or the second major surface, where the substrate includes a composition of 1-99 wt. % of an organic polymer and 1-99 wt. % of an inorganic filler.
A leak detection sensor including a dielectric substrate including a circuit board material; and a plurality of electrical circuits in communication with the substrate, where the plurality of electrical circuits are located on different sides of the substrate.
G01M 3/18 - Examen de l'étanchéité des structures ou ouvrages vis-à-vis d'un fluide par utilisation d'un fluide ou en faisant le vide par détection de la présence du fluide à l'emplacement de la fuite en utilisant des moyens de détection électrique pour tuyaux, câbles ou tubesExamen de l'étanchéité des structures ou ouvrages vis-à-vis d'un fluide par utilisation d'un fluide ou en faisant le vide par détection de la présence du fluide à l'emplacement de la fuite en utilisant des moyens de détection électrique pour raccords ou étanchéité de tuyauxExamen de l'étanchéité des structures ou ouvrages vis-à-vis d'un fluide par utilisation d'un fluide ou en faisant le vide par détection de la présence du fluide à l'emplacement de la fuite en utilisant des moyens de détection électrique pour soupapes
G01N 27/06 - Recherche ou analyse des matériaux par l'emploi de moyens électriques, électrochimiques ou magnétiques en recherchant l'impédance en recherchant la résistance d'un liquide
G08C 17/02 - Dispositions pour transmettre des signaux caractérisées par l'utilisation d'une voie électrique sans fil utilisant une voie radio
A irradiation welding apparatus including an irradiation welding generator having at least one irradiation welding head configured to apply an irradiation treatment to end contact surfaces of a first profile and a second profile to join the first profile and the second profile, where the at least one irradiation welding head forms a planar cross-sectional shape in an x-y directional plane relative to the irradiation welding generator.
A bearing for an at least partially spherical component, the bearing including a first portion and a complementary second portion integral with the first portion and joined by a folded-over bridge portion, the first portion and the second portion each including an arcuate inner surface, where the first portion and the second portion are adapted to at least partially surround and provide a compressive spring force against the component to form a joint assembly allowing for rotation of the component, where the first portion and the second portion form a semispherical void around the component, and where the bearing includes a metal substrate and a low friction layer overlying at least one surface of the substrate.
The subject application relates to polyurethane foam and methods of forming the same. A polyurethane foam may include a first polyol component and a second polyol component. The first polyol component may include a polyether polyol having a functionality of at least about 5. The second polyol component may include at least one component selected from the group of a polyether polyol having a functionality of not greater than about 4, and a polyester polyol having a functionality of not greater than about 4.
The subject application relates to polyurethane foam and methods of forming the same. A polyurethane foam may include a first polyol component and a second polyol component. The first polyol component may include a polyether polyol having a functionality of at least about 5. The second polyol component may include at least one component selected from the group of a polyether polyol having a functionality of not greater than about 4, and a polyester polyol having a functionality of not greater than about 4.
Systems and methods include providing an annular seal stack for an assembly. The seal stack assembly is disposed between a probe and a housing of the assembly and configured to provide a radial seal between the probe and the housing. The seal stack assembly includes a first metallic seal, a second metallic seal, and a wiper assembly disposed between the first metallic seal and the second metallic seal. The wiper assembly includes a first wiper housing component having a tapered inner surface, a second wiper housing component having a tapered inner surface opposite the tapered inner surface of the first wiper housing component, and a wiper disposed between the first wiper housing component and the second wiper housing component.
F16J 15/06 - Joints d'étanchéité entre surfaces immobiles entre elles avec garniture solide comprimée entre les surfaces à joindre
F16J 15/16 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre
E21B 19/00 - Manipulation de tiges, tubages, tubes ou autre objets analogues à l'extérieur du trou de forage, p. ex. dans la tour de forageAppareils pour faire avancer les tiges ou les câbles
F16J 15/56 - Autres joints pour tiges à mouvement alternatif
Systems and methods include providing an annular seal stack for an assembly. The seal stack is disposed within an annulus formed between a probe and a housing of the assembly and configured to provide a radial seal between the probe and the housing. The seal stack includes a first support retainer, a first lipseal, a first seal support system comprising at least one support ring disposed between the first support retainer and the first lipseal, a second support retainer configured to support the first lipseal, a second lipseal, a second seal support system comprising at least one support ring disposed between the second support retainer and the second lipseal, and a third support retainer configured to support the second lipseal.
F16J 15/06 - Joints d'étanchéité entre surfaces immobiles entre elles avec garniture solide comprimée entre les surfaces à joindre
F16J 15/16 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre
F16J 15/3204 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre
E21B 19/00 - Manipulation de tiges, tubages, tubes ou autre objets analogues à l'extérieur du trou de forage, p. ex. dans la tour de forageAppareils pour faire avancer les tiges ou les câbles