Abstract

Provided are a gRNA targeting sequence for specifically targeting the human INDO gene and a use thereof, wherein the nucleotide sequence of the gRNA targeting sequence is 5'-CAGTAGAAGTTAACTTGGCC-3'. Two single-stranded oligo sequences are designed and synthesized according to the gRNA targeting sequence, are annealed to form a double strand, and are then ligated to a Cas9 vector, and the gRNA and CRISPR system are introduced into a target cell by using the Cas9 vector, wherein the Cas9 protein will find the matching DNA sequence under the guidance of the gRNA and perform cleavage to achieve the knockout of the INDO gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Disclosed is a method for knocking out the human APRF gene by using CRISPR-Cas9 gene editing technology. The method comprises the following specific operation steps: (1) design of a sgRNA sequence, (2) ligation, transformation and amplification of the sgRNA, (3) plasmid transfection of 293T cells and packaging same into lentiviruses, (4) lentiviral infection of the target cell and screening same with puromycin, and (5) verification of the APRF gene knockout result.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/86 - Viral vectors

Abstract

Provided is a method for applying a CRISPR/Cas9 system in knocking out mice AILIM gene.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

An RNAi interference fragment targeting a human NGL gene, a vector comprising the RNAi, a preparation method therefor, and an application thereof. The RNAi interference fragment, as shown in SEQ ID NO. 1, can guide LwCas13a to accurately recognize and cleave mRNA formed by transcription of the human NGL gene, thereby achieving efficient and specific expression interference of the NGL gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided is a plasmid pRNAT-LwCas13a-Neo expressing the LwCas13a gene. The plasmid is constructed by the recombination of the CDS sequence of the LwCas13a gene and the pRNAT-U6.1/Neo eukaryotic expression vector. The nucleotide sequence thereof is as shown in SEQ ID NO.1. Also provided are a method for constructing the plasmid expressing the LwCas13a gene and the use thereof. The plasmid expressing the LwCas13a gene provided herein can replace the existing plasmid for RNA interference, and can induce the production of RNA interference with a higher specificity and lower off-target rate in cells.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Abstract

Provided is a method for the targeted knockout of human CNIH2 gene by applying a CRISPR/Cas9 system.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Abstract

A method for a targeted knockout of human Lgals9 gene based on CRISPR/Cas9 and a specific gRNA thereof.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/86 - Viral vectors

Abstract

Provided is a MCDR2 gene knock-out mouse obtained by using a CRISPR-Cas9 system to edit an MCDR2 gene and performing somatic cell nuclear transfer. sgRNA is designed for the CDS region of the mouse MCDR2 gene and is cleaved by means of the CRISPR-Cas9 system to achieve knock-out of the MCDR2 gene, and then corresponding knock-out mouse individuals are obtained, a practical method for the study of the mouse MCDR2 gene being provided.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided is a JM2 gene knockout mouse obtained by editing JM2 gene using a CRISPR-Cas9 system and by using somatic cell nuclear transfer techniques. Provided is a sgRNA designed for a CDS region of mouse JM2 gene. The gene is cleaved by using the CRISPR-Cas9 system to achieve the knockout of JM2 gene, and therefore a corresponding knockout mouse is obtained. The present invention provides a practicable method for mouse JM2 gene studies.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

A GL-R gene knock-out mouse is obtained by editing a GL-R gene using a CRISPR-Cas9 system and performing somatic cell nuclear transfer. sgRNA is designed for the CDS region of the mouse GL-R gene, and is cleaved by means of the CRISPR-Cas9 system to achieve knock-out of the GL-R gene for the first time, and corresponding knock-out mouse individuals are obtained, providing a practical method for the study of the mouse GL-R gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

Provided is the use of the CRISPR-Cas9 system to edit the LIGHTR gene, and LIGHTR knockout mice are obtained by means of somatic cell nuclear transfer technology. sgRNA is designed for the first time in the CDS region of the mouse LIGHTR gene, and the above is cut using the CRISPR-Cas9 system, thus achieving knockout of the LIGHTR gene and obtaining a corresponding knockout mouse individual; a practical method for studying the mouse LIGHTR gene is thus provided.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Abstract

Provided are an LncRNA DLX6-AS1 overexpression vector and a preparation method therefor. The LncRNA DLX6-AS1 overexpression vector comprises a complete LncRNA DLX6-AS1 having a sequence as shown in SEQ ID NO. 1, which may efficiently express LncRNA DLX6-AS1 and improve the efficiency of functional studies thereof.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Abstract

Provided is a recombinant vector for promoting CDC42 protein overexpression, comprising a CDC42 coding sequence and a pEGFP-C1 vector. The pEGFP-C1 vector comprises XhoI and EcoRI restriction enzyme cutting sites, and the CDC42 sequence is inserted into the restriction enzyme cutting sites in a forward direction. The recombinant vector for promoting CDC42 protein overexpression has advantages of high transfection efficiency, promotion of BNP protein overexpression, wherein the expression is continuous and stable, and a simple construction method.

IPC Classes  ?

• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals

Abstract

Provided in the present inventon is a recombinant vector for promoting the overexpression of the POU5F1 protein, belonging to the technical field of biology. The recombinant vector comprises a POU5F1 coding sequence and a pEGFP-C1 vector. The pEGFP-C1 vector comprises XhoI and EcoRI restriction sites, and the POU5F1 sequence is forwardly inserted into the restriction sites. The recombinant vector for promoting the overexpression of the POU5F1 protein provided by the present invention has the advantages of a high transfection efficiency, promoting the overexpression of a BNP protein, and consistent and stable expression, and the construction method therefor is also simple.

IPC Classes  ?

• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
• C12N 15/68 - Stabilisation of the vector
• C12N 15/70 - Vectors or expression systems specially adapted for E. coli

Abstract

A method for knocking out a mouse CD366 gene using a CRISPR/Cas9 system: first acquiring a DNA sequence for a gRNA identification region of a mouse CD366 gene; next designing a gRNA that targets the DNA sequence, and constructing a gRNA in-vitro transcription vector containing a T7 promoter for the CD399 gene; and finally using the Cas9 and gRNA in-vitro transcription vector to acquire Cas9mRNA and gRNA, the Cas9mRNA and gRNA being acquired by means of injecting fertilised eggs.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/86 - Viral vectors

Abstract

Provided are a method for a targeted knockout of human ASP2 gene based on CRISPR/Cas9 and a specific gRNA thereof. The method comprises: according to design principles of CRISPR/Cas9, designing two target sites upstream and downstream of human ASP2 gene, respectively, synthesizing corresponding oligonucleotide sequences, ligating into px459 vector to construct a recombinant plasmid, transfecting the recombinant plasmid into a human esophageal cancer cell line, and performing specific knockout of human ASP2 gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Provided are a modified vector for the human PIN1 gene editing and a preparation method therefor and the use thereof. The PIN1 gene-editing modified vector edits the human PIN1 gene by the GRISPR/Cpf1 system at the cellular level, and is used for the obtained PIN1 gene-editing positive cell.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

The present invention relates to the field of biotechnology. Provided are a human CD272 gene-targeting novel RNAi fragment, an RNAi carrier, a preparation method for same, and applications thereof. The human CD272 gene-targeting novel RNAi fragment is characterized in that the sequence of the novel RNAi fragment is as represented by SEQ ID NO. 1. The novel RNAi fragment provided in the present invention is capable of guiding LwCas13a to perform precision identification and cleaving of an mRNA formed by a transcription of human CD272 gene, thus implementing highly efficient and specific interference to the expression of CD272 gene.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Abstract

Provided are an RNAi interference fragment targeting human KAT13D gene, an RNAi vector, and a preparation method and application thereof. The RNAi interference fragment has a sequence as shown in SEQ ID NO.1. The RNAi interference fragment can interfere with the expression of KAT13D gene.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression

Abstract

A novel human INDO gene-targeted RNAi interference fragment, a carrier comprising the RNAi, and a preparation method therefor and an application thereof. The RNAi interference fragment is as shown in SEQ ID NO.1, and can guide LwCas13a to perform accurate identification and cutting on mRNA formed by transcribing the human INDO gene to achieve specific expression interference of the INDO gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease

Abstract

The present invention relates to the field of biotechnology, and provides a human APRF gene-targeted novel RNAi fragment, an RNAi vector, and preparation method therefor and application thereof. The human APRF gene-targeted novel RNAi fragment is characterized in that the sequence of the novel RNAi fragment is as represented by SEQ ID NO. 1. The novel RNAi fragment provided by the present invention can guide LwCas13a to perform accurate recognition and cleavage on mRNA formed by human APRF gene transcription, thereby implementing high-efficient and specific expression interference on an APRF gene.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Abstract

Disclosed are a gRNA targeting sequence that specifically targets the human KAT13D gene and the use thereof, wherein the nucleotide sequence of the gRNA targeting sequence is 5'-CAAACGCCAGCGGCGGTGAC-3'. The knockout of the KAT13D gene is achieved by introducing the gRNA and CRISPR system into target cells using the Cas9 vector.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided is a gRNA targeting sequence for specifically targeting human NGL gene, which has a nucleotide sequence of 5'-AGCTGAGATTCCCCTCCATT-3'. Knockout of the NGL gene is achieved after introducing the gRNA and the CRISPR system into the target cell by the Cas9 carrier.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided are a method for CRISPR/Cas9-targeted knockout of a human Tp55 gene, and specific gRNA therefor. The method comprises: designing two target sites at upstream and downstream of human Tp55 gene according to the design principle of CRISPR/Cas9, synthesizing a corresponding oligonucleotide sequence, connecting the sequence to a px459 vector to construct a recombinant plasmid, and transfecting the recombinant plasmid to a human esophageal carcinoma cell strain to specifically knock the human Tp55 gene out.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Provided are a method for targeted knockout of the human NARC1 gene with CRISPR/Cas9 and the specific gRNA thereof. According to the design principle of CRISPR/Cas9, the method comprises: designing two target sites upstream and downstream of the human NARC1 gene; synthesizing corresponding oligonucleotide sequences and ligating same to px459 vector for the construction of a recombinant plasmid; transfecting the recombinant plasmid into a human esophageal cancer cell line for specifically knocking out the human NARC1 gene. The method can be applied to the clinical treatment of the human NARC1 gene-related diseases.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Provided are a lncRNA AFAP1-AS1 overexpression vector and a preparation method thereof. The lncRNA AFAP1-AS1 overexpression vector contains complete lncRNA AFAP1-AS1 expression sequence as shown in SEQ ID NO.1. The constructed lncRNA AFAP1-AS1 overexpression vector can efficiently express lncRNA AFAP1-AS1, thereby improving the efficiency of functional studies thereof.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Abstract

A LncRNA DB327252 over-expression vector. The sequence of a LncRNA DB327252 fragment is shown as SEQ ID NO.1.

IPC Classes  ?

• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

A recombinant vector for promoting the overexpression of AT2R protein, which relates to the field of biotechnology and which comprises an AT2R coding sequence and a pEGFP-C1 vector; the pEGFP-C1 vector comprises XhoI and EcoRI cleavage sites, and the AT2R sequence is positively inserted into the cleavage sites. The recombinant vector which promotes the overexpression of AT2R protein has the advantages of having high transfection efficiency, promoting the overexpression of AT2R protein, and expression being continuous and stable, while the construction method is simple.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/79 - Vectors or expression systems specially adapted for eukaryotic hosts

Abstract

A recombinant vector for promoting overexpression of a PDSS2 protein, comprising a PDSS2 coding sequence and a pEGFP-C1 vector. The pEGFP-C1 vector comprises XhoI and EcoRI restriction enzyme cleavage sites, and the PDSS2 sequence is inserted forward into the restriction enzyme cleavage site.

IPC Classes  ?

• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided is a recombinant vector for promoting overexpression of PINK1 protein, comprising a PINK1 coded sequence and a pEGFP-C1 vector. The pEGFP-C1 vector comprises XhoI and EcoRI digestion sites, and the PINK1 sequence is inserted into the digestion sites in a positive direction. The recombinant vector for promoting overexpression of PINK1 protein provided has advantages of high transfection efficiency, promoting overexpression of BNP protein, and continuously stable expression. The construction method is simple.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
• C12N 15/67 - General methods for enhancing the expression

Abstract

Disclosed is a method for the site-directed integration of the SLEB2 gene into a Jurkat cell, which method uses an insect protein expression system to synthesize the necessary components required for a recombinant adeno-associated virus (rAAV), and achieves the aim of integrating the SLEB2 gene in a site-directed manner into the AAVS1 locus of chromosome 19 in a Jurkat cell.

IPC Classes  ?

• C12N 15/12 - Genes encoding animal proteins
• C12N 15/86 - Viral vectors
• C12N 5/22 - Human cells

Abstract

A lentivirus-based CRISPR/Cpf1 gene editing vector and application thereof. On the basis of a conventional lentivirus vector pLVX-shRNA1, an expression cassette constituted by a PGK promoter-puromycin resistance gene is completely replaced by an expression cassette constituted by a CAG promoter-Cpf1 gene-2A peptide-puromycin resistance gene, so as to obtain a recombinant lentivirus vector which can be used for Cpf1 gene editing. Recombinant lentivirus obtained by a lentivirus packaging process can infect a target cell in vitro and edit a target gene.

IPC Classes  ?

• C12N 15/867 - Retroviral vectors
• C12N 15/86 - Viral vectors
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 7/01 - Viruses, e.g. bacteriophages, modified by introduction of foreign genetic material
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy

Abstract

Provided are a modification vector for human ALPS5 gene editing and a preparation method and application thereof. By editing human ALPS5 gene at a cellular level using a CRISPR/Cpf1 system, ALPS5 gene editing-positive cells are obtained.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided are a modified vector for human CD357 gene editing, a preparation method therefor and the use thereof. The human CD357 gene is edited by the CRISPR/Cpf1 system at the cellular level, and the modified vector is used for the obtained CD357 gene-editing positive cell.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

A modified vector used for human TNFSF18 gene editing, a preparation method therefor and an application thereof. The modified vector used for TNFSF18 gene editing has strong specificity and may be used to extremely effectively edit the human TNFSF18 gene at the cellular level by means of a CRISPR/Cpf1 system, being used to obtain TNFSF18 gene-editing positive cells, thus laying the foundation for research related to the TNFSF18 gene.

IPC Classes  ?

• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12N 9/22 - Ribonucleases
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Provided is a gRNA sequence for knocking out cellular human CDw137 gene. In a cell, gRNA can be specifically bound to the 144-163bp of a human CDw137 DNA sense strand, and forms a complex with Cas9; a CDw137 gene nucleic acid sequence is specifically cut; a CDw137 gene frame-shift mutation is caused by using a cellular non-recombinant end connection repair mechanism; and then a CDw137 gene knockout cell is obtained.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

A gRNA sequence for knocking out the human cell TNFSF9 gene is provided. In the cell, the gRNA can specifically bind to the human TNFSF9 DNA positive-sense strand 261-280th bp, and form a complex with Cas9; the TNFSF9 gene nucleic acid sequence is specifically cleaved, and a cell non-recombinant end joining repair mechanism is used to cause a TNFSF9 gene frameshift mutation to obtain TNFSF9 gene knockout cells.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease

Abstract

Provided is a method for knocking out the human CT1.1 gene by using CRISPR-Cas9 gene editing technology, the method comprising the following specific operation steps: (1) design of an sgRNA sequence, (2) ligation, transformation and amplification of the sgRNA, (3) plasmid transfection of 293T cells and packaging same into lentiviruses, (4) lentiviral infection of the target cell and screening with puromycin, and (5) verification of the CT1.1 gene knockout result. The method can be applied to drug research and development associated with CT1.1.

IPC Classes  ?

• C12N 15/90 - Stable introduction of foreign DNA into chromosome
• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells

Abstract

Provided is a gRNA sequence for knocking out the human cell ACT35 gene. In cells, the gRNA is capable of specifically binding to the sense strand (438-457 bp) of the human ACT35 DNA, and forming a complex with Cas9, and specifically cleaving the nucleic acid sequence of the ACT35 gene. By using the cell non-recombinant end connection repair mechanism, frameshift mutation of the ACT35 gene occurs, so as to obtain ACT35 gene-knockout cells.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided is a method for targeting knockout of the human ALPS5 gene using the CRISPR/Cas9 system. The method comprises: designing a gRNA that targets the human ALPS5 gene according to the PAM design principle of the gRNA; linking the gRNA to the px459 vector for obtaining a recombinant vector for the targeting knockout of the human ALPS5 gene; transforming the recombinant vector into Jurkat cells; and carrying out the targeting knockout of the human ALPS5 gene.

IPC Classes  ?

• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Provided is a method for the targeted knockout of a human CD357 gene by applying a CRISPR/Cas9 system. The method comprises: designing a gRNA according to the PAM design principle of gRNA by means of analyzing the specifics of a human CD357 gene sequence, linking the gRNA with a px459 vector to obtain a recombinant vector for the targeted knockout of the human CD357 gene, and using the gRNA in Jurkat cells to guide a CRISPR/Cas9 system to knock out the human CD357 gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided is a method for the targeted knockout of a human TNFSF18 gene by applying a CRISPR/Cas9 system.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Abstract

A gRNA targeting sequence of a specific target human CD272 gene and an application thereof, relating to the technical field of gene editing. The gRNA targeting sequence has a nucleotide sequence of 5'-TGTTCCAGATGTCCAGATAT-3'. According to the gRNA targeting sequence, two single-stranded oligo sequences are designed and synthesized and then are annealed to form a double chain, and then the double chain is connected to a Cas9 vector; by using the Cas9 vector, gRNA and a CRISPR system are introduced into target cells, a Cas9 protein may find out a DNA sequence matched with the Cas9 protein under the guidance of the gRNA, shearing is performed, and the CD272 gene is knocked out.

IPC Classes  ?

• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
• C12N 15/90 - Stable introduction of foreign DNA into chromosome
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided are a method for specifically knocking out the human C2orf40 gene by CRISPR-Cas9 and a specific sgRNA thereof.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Abstract

Provided are a method for specifically knocking out a human MER6 gene by means of CRISPR-Cas9, and a specific sgRNA thereof. By means of computer simulation, computation, and design, a group of sgRNAs specifically knocking out a specifically targeted MER6 gene in the human MER6 gene by using the CRISPR-Cas9 is synthesized, the sgRNA and a linear PX330 plasmid are separately connected to be a vector, the cell is transfected, i.e., the knockout of the MER6 gene can be realized. The sgRNA has the advantage that mass production can be performed with a small amount of synthesized polynucleotide fragments; a preparation method is simple and easy to perform; the sgRNA has good targetability; and the knockout efficiency of a CRISPR-Cas9 system is high.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Disclosed is a construction method of a CHO cell strain having a site-specific inserted CDw137 gene and a use thereof. For the cell strain, a CRISPR/Cas9 system-based sgRNA expression vector is constructed according to the nucleotide sequence at the insertion site, and an expression cassette containing a CDw137 gene and capable of being integrated into a host genome is constructed based on the action site of the sgRNA. The constructed sgRNA expression vector and the linearized expression cassette are then co-transfected into a CHO cell, followed by screening to obtain a CHO cell strain having a site-specific inserted CDw137 gene.

IPC Classes  ?

• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
• C12N 15/90 - Stable introduction of foreign DNA into chromosome
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Disclosed are a method for constructing a 293T cell strain with site-directed insertion of the TNFSF9 gene and a use thereof. The cell strain is obtained by constructing an sgRNA expression vector based on a CRISPR/Cas9 system according to the nucleotide sequence of an insertion site; constructing, according to an sgRNA action site, an expression cassette that contains the TNFSF9 gene and can be integrated into a host genome; then co-transfecting the constructed sgRNA expression vector and a linearized expression cassette into 293T cells; and screening to obtain the 293T cell strain with site-directed insertion of the TNFSF9 gene. The cell strain can maintain the efficient and stable expression of the TNFSF9 protein for a long period of time.

IPC Classes  ?

• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells

Abstract

Disclosed are a method for constructing a CHO cell strain with site-directed insertion of the CT1.1 gene and a use thereof. The cell strain is obtained by constructing an sgRNA expression vector based on CRISPR/Cas9 system according to the nucleotide sequence of an insertion site; constructing, according to an sgRNA action site, an expression cassette that contains the CT1.1 gene and can be integrated into a host genome; then co-transfecting the constructed sgRNA expression vector and a linearized expression cassette into CHO cells; and screening to obtain the CHO cell strain with site-directed insertion of the CT1.1 gene. The cell strain can maintain the efficient and stable expression of the CT1.1 protein for a long period of time.

IPC Classes  ?

• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
• C12N 15/90 - Stable introduction of foreign DNA into chromosome
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided are a method for constructing a CHO cell strain with an ACT35 gene inserted at a fixed point and the use thereof. The cell strain is characterized in that an sgRNA expression vector based on a CRISPR/Cas9 system is constructed according to a nucleotide sequence of an insertion site, and an expression cassette containing an ACT35 gene and capable of being integrated into a host genome is constructed according to an sgRNA action site, then the constructed sgRNA expression vector and the linearized expression cassette are cotransfected into CHO cells, and a CHO cell strain with the ACT35 gene inserted at a fixed point is obtained after screening. The obtained cell strain can maintain high-efficiency and stable expression of the ACT35 protein for a long time.

IPC Classes  ?

• C12N 15/90 - Stable introduction of foreign DNA into chromosome
• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells

Abstract

Disclosed are a method for constructing a 293T cell strain with site-directed insertion of the BTDC gene and a use thereof. The cell strain is obtained by constructing an sgRNA expression vector based on a CRISPR/Cas9 system according to the nucleotide sequence of an insertion site; constructing, according to an sgRNA action site, an expression cassette that contains the BTDC gene and can be integrated into a host genome; then co-transfecting the constructed sgRNA expression vector and a linearized expression cassette into 293T cells; and screening to obtain the 293T cell strain with site-directed insertion of the BTDC gene. The obtained cell strain can maintain the efficient and stable expression of the BTDC protein for a long period of time.

IPC Classes  ?

• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Disclosed is a method for the site-directed integration of the MTABC3 gene into an A375 cell, which method uses an insect protein expression system to synthesize the necessary components required for a recombinant adeno-associated virus (rAAV), and achieves the aim of integrating the MTABC3 gene in a site-directed manner into the AAVS1 locus of chromosome 19 in an A375 cell.

IPC Classes  ?

• C12N 15/12 - Genes encoding animal proteins
• C12N 15/86 - Viral vectors
• C12N 5/22 - Human cells

Abstract

A method for fixed-site integration of an HDMX gene into MCF-7 cells, using an insect protein expression system to synthesise the necessary elements required for recombinant adeno-associated virus (rAAV), and achieving the objective of fixed-site integration of an HDMX gene into the AAVS1 site of chromosome 19 of MCF-7 cells. The transformed MCF-7 cells stably over-express the HDMX protein, and the necessary elements for rAAV being synthesised from an insect protein expression system avoids the risk of potential endotoxin contamination by an E. coli gene cloning system, enhancing the safety and usability of the MCF-7 cells in preclinical research.

IPC Classes  ?

• C12N 7/01 - Viruses, e.g. bacteriophages, modified by introduction of foreign genetic material
• C12N 15/866 - Baculoviral vectors

Abstract

Disclosed is a method for the site-directed integration of the TXGP1 gene into a Raji cell, which method uses an insect protein expression system to synthesize the necessary components required for a recombinant adeno-associated virus (rAAV), and achieves the aim of integrating the TXGP1 gene in a site-directed manner into the AAVS1 locus of chromosome 19 in a Raji cell.

IPC Classes  ?

• C12N 15/12 - Genes encoding animal proteins
• C12N 15/86 - Viral vectors
• C12N 5/22 - Human cells

Abstract

Disclosed is a method for the site-directed integration of the CD274 gene into a Jurkat cell, which method uses an insect protein expression system to synthesize the necessary components required for a recombinant adeno-associated virus (rAAV), and achieves the aim of integrating the CD274 gene in a site-directed manner into the AAVS1 locus of chromosome 19 in a Jurkat cell. The method allows the modified Jurkat cell to stably overexpress the CD274 protein, and since all the components necessary for the rAAV are synthesized by the insect protein expression system, the method avoids the risk of potential endotoxin contamination brought about by the Escherichia coli gene cloning system and greatly enhances the safety and utility of Jurkat cells for preclinical studies.

IPC Classes  ?

• C12N 15/866 - Baculoviral vectors

Abstract

Provided are a modified vector for human CNIH2 gene editing, preparation method therefor and application thereof, relating to the technical field of genetic engineering. The provided modified vector for CNIH2 gene editing can edit a human CNIH2 gene at the cellular level by means of CRISPR/Cpf1 system, so as to obtain a CNIH2 gene-edited positive cell.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

Provided is a gRNA sequence for knocking out human BTDC gene. In a cell, gRNA can be specifically bound to the 605-624bp of a human BTDC DNA sense strand, and forms a complex with Cas9; a BTDC gene nucleic acid sequence is specifically cut; a BTDC gene frame-shift mutation is caused by using a cellular non-recombinant end connection repair mechanism; and then a BTDC gene knockout cell is obtained.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease

Abstract

Provided is a gRNA for the specific and targeting knockout of the human MTABC3 gene. The sequence of the gRNA is as shown in SEQ ID NO. 1. The human MTABC3 gene may be knocked out by using the gRNA and the CRISPR/Cas9 system guided by the combination thereof in A375 cells.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

A method for knocking out a human HDMX gene by using CRISPR-Cas9 gene editing technology, comprising: (1) designing an sgRNA sequence; (2) ligating, transforming and amplifying the sgRNA; (3) a transfecting 293T cell with a plasmid and packaging into a lentivirus; (4) infecting a target cell with the lentivirus and screening using puromycin; (5) verifying an HDMX gene knockout result. In the method, an HDMX gene of a cell may be knocked out and may be used for drug research and development related to HDMX.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12N 15/86 - Viral vectors
• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
• C12N 5/09 - Tumour cells

Abstract

Guide RNA (gRNA) the gRNA sequence of which is based on a CRISPR/Cas9 system and a combination of which is used for the specific targeted knockout of a human TXGP1 gene. GRNA is designed according to the design principles of CRISPR/Cas9, the sequence thereof being shown in SEQ ID NO. 1, and the gRNA being constructed on a px459 vector. A human TXGP1 gene may be efficiently knocked out in Jurkat cells by using a CRISPR/Cas9 system guided by such gRNA and a combination thereof. The prepared gRNA may be used to precisely target a human TXGP1 gene and achieve gene knockout. The preparation method is simple in operation, gRNA targeting is good, and the knockout efficiency of the CRISPR/Cas9 system is high.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/90 - Stable introduction of foreign DNA into chromosome
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy

Abstract

The present invention relates to a guide RNA (gRNA) sequence based on a CRISPR/Cas9 system and a combination thereof, as well as gRNA for a specific targeted knockout human SLEB2 gene. The gRNA is designed according to the design principle of CRISPR/Cas9, has a sequence as shown in SEQ NO. 1, and is constructed on a px459 vector. The human SLEB2 gene can be knocked out by using the gRNA and the CRISPR/Cas9 system guided by the combination thereof in a Jurkat cell. The human SLEB2 gene can be targeted by using the prepared gRNA, and gene knockout is implemented.

IPC Classes  ?

• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Provided are CRISPR/Cas9 system-based directed RNA(gRNA) sequences and combinations thereof in preparation of gRNA for specifically targeted knockout of the human PDCD1L1 gene. The gRNA is designed according to a CRISPR/Cas9 design principle, the sequence of the gRNA is as shown in SEQ ID NO.1, and the gRNA is constructed on a px459 vector. In Jurkat cells, the CRISPR/Cas9 system directed by the gRNA and combination thereof can effectively knock out the human PDCD1L1 gene. The prepared gRNA can accurately target the human PDCD1L1 gene and implement a gene knockout. The preparation method is simple in operation, the gRNA is good in targeting, and knockout efficiency of the CRISPR/Cas9 system is high.

IPC Classes  ?

• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
• C12N 15/867 - Retroviral vectors
• C12N 15/12 - Genes encoding animal proteins
• A01K 67/027 - New or modified breeds of vertebrates
• A61K 49/00 - Preparations for testing in vivo
• A61K 39/395 - AntibodiesImmunoglobulinsImmune serum, e.g. antilymphocytic serum

Abstract

Provided is a method for knocking out a human PIN1 gene by using a CRISPR-Cas9 gene editing technology. Specific operation steps comprise: (1) designing an sgRNA sequence; (2) performing connection, conversion and amplification of sgRNA; (3) performing plasmid transfection on a 293T cell and packaging same to lentivirus; (4) performing lentivirus infection on a target cell and performing puromycin screening; and (5) performing verification on a PIN1 gene knockout result. Experiments prove that the provided method for knocking out the PIN1 gene can efficiently knock out the PIN1 gene of a cell, and can serve as a powerful tool to be applied to PIN1-related drug research and development.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/867 - Retroviral vectors
• C12N 15/90 - Stable introduction of foreign DNA into chromosome
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy

Abstract

Provided are a method for specifically knocking out the human PSSALRE gene by CRISPR-Cas9 and a specific sgRNA thereof. The method comprises: through computer simulation, calculation and design, synthesizing a set of sgRNAs specifically targeting the PSSALRE gene when specifically knocking out the human PSSALRE gene by CRISPR-Cas9; respectively linking the sgRNA to a linear PX330 plasmid to form a vector; and transfecting cells with same so as to achieve the knockout of the PSSALRE gene.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12N 9/12 - Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)

Abstract

Provided are the construction and use of an miRNA-128 overexpression vector. The role of miR-128 in tumors is studied by constructing the miR-128 overexpression recombinant vector and overexpressing same in LNCap cells.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/67 - General methods for enhancing the expression

Abstract

Provided are a construction and application of a miRNA-210 overexpression recombinant vector. The function of miR-210 in tumors is studied by constructing a miR-210 overexpression recombinant vector and overexpressing same in LN-18 cells. Experimental results show that the recombinant vector is successfully and efficiently expressed at the cellular level, and the expression level of miR-210 is greatly increased.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease

Abstract

A mammalian virus-mediated miRNA overexpression method. The overexpression of endogenous target miRNA in a tumor cell is implemented mainly by infecting the tumor cell with a mammalian virus carrying a target miRNA precursor fragment.

IPC Classes  ?

• C12N 15/86 - Viral vectors
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

A mammalian virus-based method for mediating miRNA overexpression: overexpressing tumor cell endogenous target miRNA by means of infecting a tumor cell by using a mammalian virus carrying a human miR-184 precursor fragment.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
• C12N 15/86 - Viral vectors

Abstract

Provided are a miR-21 overexpressing recombinant vector and a construction method therefor and an application thereof. The function of miR-21 in tumors is studied by constructing a miR-21 overexpressing recombinant vector and overexpressing same in HepG2 cells.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/67 - General methods for enhancing the expression

Abstract

Provided are construction of a miRNA-25 overexpression recombinant vector and use thereof. The effect of miR-25 in tumors is investigated by constructing a miR-25 overexpression recombinant vector and overexpressing same in HCT116 cells. Experimental results show that said recombinant vector is successfully expressed at the cellular level efficiently, and the expression level of miR-25 is greatly increased.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease

Abstract

Provided are an miRNA-145 over-expression recombinant vector and a construction method therefor, the miRNA-145 over-expression recombinant vector comprising the nucleotide shown in SEQ ID NO: 1.

IPC Classes  ?

• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

A Mammalian virus-mediated miRNA overexpression method, which achieves overexpression of an endogenous target miRNA in tumor cells by mainly infecting the tumor cells with a mammalian virus carrying a target miRNA precursor fragment.

IPC Classes  ?

• C12N 15/86 - Viral vectors
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Provided is a mammalian virus-mediated miRNA overexpression method. Said method achieves overexpression of miR-143 in tumor cells by infecting the tumor cells with a mammalian virus carrying a miR-143 precursor fragment.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/67 - General methods for enhancing the expression

Abstract

Provided is a method for mediating miRNA overexpression based on a mammalian virus. The method achieves the overexpression of an endogenous target miRNA in tumor cells mainly by infecting the tumor cells with the mammalian virus carrying a target miRNA precursor fragment.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/67 - General methods for enhancing the expression
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12N 15/86 - Viral vectors

Abstract

Provided is a specific gRNA for the targeted knocking down of a human CD226 gene, wherein two target sites are designed on the human CD226 gene according to the design principle of CRISPR/Cas9 gRNA, and a corresponding oligomeric nucleotide is synthesized and then constructed on a px459 vector. The human CD226 gene may be effectively knocked out using a recombinant vector-directed CRISPR/Cas9 system in Jurkat cells. The provided gRNA-directed CRISPR/Cas9 system is expected to acquire applications in new drugs for treating tumors.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Provided is specific gRNA for targeted knockout of human VSTM3 gene. According to the design principle of CRISPR/Cas9 gRNA, two target sites are designed on human VSTM3 gene, and corresponding oligonucleotide is synthesized and then constructed on px459 vector. Under the guidance of the provided gRNA, a CRISPR/Cas9 system is expected to be applied in new-type drugs for treating tumors.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

A method for knocking out a mouse MOP3 gene using a CRISPR/Cas9 system, the method comprising: obtaining a DNA sequence for a gRNA recognition region of a mouse MOP3 gene; designing a gRNA that targets the DNA sequence, and constructing a gRNA in-vitro transcription vector that targets the MOP3 gene and contains a T7 promoter; finally, using an in-vitro transcription vector of Cas9 and gRNA to obtain Cas9 mRNA and gRNA. The Cas9 mRNA and gRNA obtained by means of injecting a fertilized egg with the in-vitro transcription vector may be used to produce a transgenic mouse containing a MOP3 gene mutation.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/86 - Viral vectors

Abstract

On the basis of a design principle for CRISPR/Cas9 gRNA, two target sites are designed on human GI24 gene, a corresponding oligonucleotide is synthesized, and same is constructed on carrier px459. A CRISPR/Cas9 system guided by utilizing the recombinant carrier in Jurkat cells allows the effective knockout of human GI24 gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/86 - Viral vectors

Abstract

Provided is a method for knocking out the mouse EBLN1 gene by using a CRISPR/Cas9 system. The method comprises: firstly, obtaining the DNA sequence for the gRNA recognition region of the mouse EBLN1 gene; then, designing gRNAs that target the DNA sequence and constructing a T7-promoter-containing gRNA in vitro transcription vector for the EBLN1 gene; and finally, using Cas9 and the gRNA in vitro transcription vector to obtain Cas9 mRNA and gRNA, wherein same can be used for producing transgenic mice with EBLN1 gene knockout.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Abstract

Provided is a gRNA for specifically targeting the human CVAP gene during the specific knockout of the human CVAP gene with CRISPR/Cas9.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression

Abstract

Provided are construction of an eukaryotic expression vector and preparation of a stable-expression cell strain by using same. The method comprises: cloning an FH3 full-length gene to a pEGFP-N1 eukaryotic expression vector with a fluorescent protein tag; transfecting HAP-s cells by using the constructed eukaryotic expression vector; and establishing an FH3 stable-overexpression HAP-s cell line.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/64 - General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
• C12N 15/12 - Genes encoding animal proteins
• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells

Abstract

Provided are a lentiviral vector of a B/T lymphocyte attenuator (BTLA) gene and a construction method therefor. The lentiviral vector is obtained by connecting the BTLA gene to a pCDH-CMV-MCS-EF1-copGFP vector. The lentiviral vector of the overexpression BTLA gene is packaged by using lentivirus packaging plasmids psPAX2 and pMD2.G, and a 293T cell is transfected, so as to obtain a BTLA lentivirus.

IPC Classes  ?

• C12N 15/12 - Genes encoding animal proteins
• C12N 15/86 - Viral vectors

Abstract

Provided are a cell line for stable expression of a platelet and T cell activation antigen 1 (PTA1) gene and a construction method therefor. The method comprises the steps of: (1), inserting a PTA1 gene sequence into a polyclonal site of a eukaryotic vector, so as to obtain a recombinant expression vector; and (2), introducing the recombinant expression vector into a host cell, and carrying out screening to obtain a cell line for stable expression of the PTA1 gene.

IPC Classes  ?

• C12N 15/12 - Genes encoding animal proteins
• C12N 15/79 - Vectors or expression systems specially adapted for eukaryotic hosts
• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells

Abstract

An shRNA for targeted silencing of a human WUCAM gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Provided is an shRNA for restricting expression of an AITR gene. Coding nucleic acid sequences of the shRNA are shown in SEQ ID NOs:1 and 2. Also provided are applications of the shRNA in the preparation of reagents for lowering AITR mRNAs of cells, application in the preparation of reagents for restricting AITR protein expression of cells, and applications in the preparation of drugs for diseases related to expression anomalies of the AITR gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• A61K 31/713 - Double-stranded nucleic acids or oligonucleotides
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61P 37/02 - Immunomodulators

Abstract

Provided are shRNA of a human GRD4 gene and an application of the shRNA. The sense strand sequence of the shRNA is as shown in SEQ ID NO: 1, and the antisense strand sequence thereof is as shown in SEQ ID NO: 2. The shRNA is designed and synthesized according to the nucleotide sequence of the human GRD4 gene, an shRNA expression vector is constructed, and the shRNA for inhibiting a GRD4 gene expression is obtained by means of functional experimental verification. Also provided is an application of the shRNA.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Provided is specific shRNA for silent target protein DD1α. A silencing vector for DD1α is constructed. First, a 19-bp shRNA core fragment is designed according to the sequence of a human DD1α gene, two ends of the synthesized fragment having suitable restriction enzyme cutting sites; the target fragment is connected to a pSUPER vector to form a core silencing vector; after transformation, a positive clone is selected for PCR verification; a correct vector is verified, DNA sequencing is performed, and then silencing efficiency is measured by means of an immunoblotting experiment. A 19-bp shRNA core fragment capable of targeting human DD1α is synthesized and designed, and the sequence of the shRNA core fragment is 5'-GGTGCAGACAGGCAAAGAT-3'.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

shRNA targeting a silent human APP gene, having a core sequence encoding nucleic acid sequence being 5'-GGGAAGTGGGATTCAGATC-3'.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

An shRNA of a human TL6 gene and applications thereof. A positive-sense strand sequence of the shRNA is shown in SEQ ID NO:1, and an antisense strand sequence of the shRNA is shown in SEQ ID NO:2. By means of the shRNA in the present invention, an shRNA expression vector is designed, synthesized and constructed according to a nucleotide sequence of the human TL6 gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61P 35/00 - Antineoplastic agents

Abstract

Provided are a method for constructing a high-expression vector of a human ARNTL gene, and applications. The method comprises the steps of: firstly, amplifying and purifying a target gene : designing an upper primer and a lower primer, extracting a cell RNA, and carrying out PCR amplification by using a reversely-transcribed cDNA as a template, and after a target band is cut, carrying out recycling and purification by using a reagent kit; and secondly, constructing and verifying a recombinant plasmid pCDNA3.1-ARNTL: after double enzyme digestion is carried out on the purified PCR product and a vector pCDNA3.1 by using Xba I and EcoR I, respectively recycling and purifying the enzyme digestion products by using reagent kits, connecting segments, carrying out screening, culture, cloning and sequencing, and detecting the gene expression condition by using a QPCR.

IPC Classes  ?

• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease

Abstract

A Tud RNA for specifically knocking down expressions of miR-148a, miR-185 and miR-424 of a human being, and applications thereof. A DNA sequence of the Tud RNA is coded, as shown in the following: 5'-ggcgctaggatcatcaacagtcacgtgatgatcttcttgaaacacaatccccgaccgaaatctaggagaccagcaagttttgcactcatctcgcgacgatacaagtattctggtcacagaatacaacagtcacgtgatgatcttcttgaaacacaatccccgaccgaaatctaggagaccagcaagttttgcactcatctcgcgacgatacaagatgatcctagcgccaccttttt-3'. The applications of the Tud RNA comprises: the Tud RNA is constructed on a lentiviral vector to obtain a recombinant vector comprising the Tud RNA; and the recombinant vector comprising the Tud RNA is applied to a cell from a human being, so as to achieve the objective for restricting miR-148a, miR-185 and miR-424 of the human being.

IPC Classes  ?

• C12N 15/09 - Recombinant DNA-technology
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61P 35/00 - Antineoplastic agents

Abstract

Provided is an shRNA for specifically knocking down a PTA1 gene. A sequence of a core segment of the shRNA is 5'-GGCAGAAGGTGATACAGGT-3'.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

An shRNA of an IDO gene of a human being and applications. The shRNA of the IDO gene of the human being comprises an IDO-RNAi formed by coding a sequence indicated by SEQ ID NO:1 and coding a sequence indicated by SEQ ID NO:2. The shRNA of the IDO gene of the human being can be used in the preparation of drugs for treating diseases related to expression anomalies of the IDO gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61P 35/00 - Antineoplastic agents

Abstract

Provided are a high-expression lentiviral vector of an IDO gene, an IDO lentivirus, and a construction method therefor. An IDO gene is integrated by means of a gene recombination technology and based on a pCDHCMV-MCS-EF1-copGFP lentivirus expression vector, so as to obtain an overexpression lentiviral vector pCDH-CMV-MCS-EF1-copGFP-IDO of an IDO gene. The overexpression lentiviral vector pCDH-CMV-MCS-EF1-copGFP-IDO of the IDO gene is packaged by using lentivirus packaging plasmids psPAX2 and pMD2.G, and a 293T cell is transfected, so as to obtain an IDO lentivirus.

IPC Classes  ?

• C12N 15/867 - Retroviral vectors
• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
• C12N 15/53 - Oxidoreductases (1)
• C12N 7/01 - Viruses, e.g. bacteriophages, modified by introduction of foreign genetic material

Abstract

An shRNA of a human ERBB2 gene. A positive-sense strand of a coding sequence of the shRNA is shown in SEQ ID NO:1, and an antisense strand of the coding sequence of the shRNA is shown in SEQ ID NO:2. The shRNA of the human ERBB2 gene can be used for the preparation of drugs for treating diseases related to expression anomalies of an ERBB2 gene.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• A61K 31/713 - Double-stranded nucleic acids or oligonucleotides
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61P 35/00 - Antineoplastic agents

Abstract

Provided are an MCF-7/HDAC6 cell strain for overexpression of HDAC6, and a construction method therefor. The cell strain is MCF-7 and contains a stable overexpression HDAC6 gene.

IPC Classes  ?

• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
• C12N 15/12 - Genes encoding animal proteins
• C12N 15/86 - Viral vectors

Abstract

Provided are a method for constructing a high-expression vector of a human CVID1 gene, and applications. The method comprises the steps of: firstly, amplifying and purifying a target gene: designing an upper primer and a lower primer, extracting a cell RNA, and carrying out PCR amplification by using a reversely-transcribed cDNA as a template, and after a target band is cut, carrying out recycling and purification by using a reagent kit; and secondly, constructing and verifying a recombinant plasmid pCDNA3.1-CVID1: after double enzyme digestion is carried out on the purified PCR product and a vector pCDNA3.1 by using Xba I and EcoR I, respectively recycling and purifying the enzyme digestion products by using reagent kits, connecting segments, carrying out screening, culture, cloning and sequencing, and detecting the gene expression condition by using a QPCR.

IPC Classes  ?

• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease

Abstract

Provided are a lentiviral vector for high expression of a CLOCK gene, a CLOCK lentivirus and a construction method therefor. The method for constructing a CLOCK lentivirus comprises: using a pCDH-CMV-MCS-EF1-copGFP lentiviral expression vector as the basis, and integrating a CLOCK gene to obtain a lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP-CLOCK for overexpression of the CLOCK gene; using lentiviral packaging plasmids psPAX2 and pMD2.G to package the lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP-CLOCK for overexpression of the CLOCK gene; and transfecting 293T cells to obtain the CLOCK lentivirus.

IPC Classes  ?

• C12N 15/867 - Retroviral vectors
• C12N 7/01 - Viruses, e.g. bacteriophages, modified by introduction of foreign genetic material

Abstract

Provided are shRNA of a human AMPAR gene and an application thereof. The shRNA inhibits the expression of an AMPAR gene, the sense strand sequence of the shRNA is represented by SEQ ID NO: 1, and the antisense strand sequence is represented by SEQ ID NO: 2.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Provided are construction of a eukaryotic expression vector and a method for preparing a stable-expression cell strain using the vector. Specifically, the method comprises cloning a CD27 full-length gene into a pEGFP-N1 eukaryotic expression vector carrying a fluorescent protein tag, and transfecting Hela cells using the constructed eukaryotic expression vector to establish a HeLa cell line stably overexpressing CD27.

IPC Classes  ?

• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
• C12N 5/16 - Animal cells

Abstract

Provided is a construction method for a human EBLN1 gene high expression vector, comprising the steps of: extracting cellular RNA; performing reverse transcription on same to obtain cDNA as a template; designing upstream and downstream primers according to a target gene; performing recovery and purification after performing PCR amplification on the target gene; next, performing double restriction digestion on a PCR product and a vector pCDNA3.1 using Xba I and EcoR I; and then connecting the PCR product and the vector pCDNA3.1 and performing screening and sequencing.

IPC Classes  ?

• C12N 15/12 - Genes encoding animal proteins
• C12N 15/79 - Vectors or expression systems specially adapted for eukaryotic hosts