Described herein are methods of utilizing single fasting methane breath concentrations to monitor, select treatment for, and to treat subjects having intestinal methanogen overgrowth.
A61B 5/08 - Measuring devices for evaluating the respiratory organs
A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
A61B 10/00 - Other methods or instruments for diagnosis, e.g. for vaccination diagnosis; Sex determination; Ovulation-period determination; Throat striking implements
2.
IPSC-DERIVED IMMUNE CELLS IN PROPHYLAXIS AND TREATMENT OF AGE-ASSOCIATED AND NEURODEGENERATIVE DISEASES
Mononuclear phagocytes derived from induced pluripotent stem cells, denoted as iMPs, which comprise monocytes generated from the induced pluripotent stem cells and optionally further macrophages generated from the induced pluripotent stem cells, are provided for use in improving cognitive function, improving neural health, and/or alleviating or treating a neurodegenerative disorder in a mammal. In various embodiments, the iMPs produce macrophages after transplantation or after being stimulated in vitro, and/or express macrophage markers. We showed that iMPs upon administration improve cognition and neural healthy in rodent models of aging, Alzheimer's disease, and amyotrophic lateral sclerosis. Treatment methods are also provided using mononuclear phagocytes generated from autologous stem cells or from induced pluripotent stem cells obtained from autologous cells in patients in need of treatment or prophylaxis of a neurodegenerative disorder.
C12N 5/00 - Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
A61K 35/15 - Cells of the myeloid line, e.g. granulocytes, basophils, eosinophils, neutrophils, leucocytes, monocytes, macrophages or mast cells; Myeloid precursor cells; Antigen-presenting cells, e.g. dendritic cells
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
3.
THERAPEUTIC NUCLEIC ACIDS AND METHODS OF USE THEREOF
An isolated nucleic acid that includes the nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12) is provided. In some embodiment, the nucleic acid includes at least one chemically-modified nucleotide. The nucleic acid and composition containing same find use in treating coniditions associated with inflammation and/or fibrosis, for example, without limitation, heart conditions, such as hypertrophic myocardiopathy, myocardial infarction, and heart failure with preserved ejection fraction; muscle disorders, such as muscular dystrophy; skin disorders, such as scleroderma; and inflammatory conditions, such as autoimmune conditions or inflammatory conditions associated with a viral infection.
A61K 31/712 - Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
C12Q 1/6876 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Provided herein are formulations configured for the oral delivery of a nucleic acid, such as a non-coding RNA. The formulations provided for herein comprise a plurality of cationic lipids used to encapsulate the nucleic acid within a micelle and a mixture of casein proteins and chitosan polymers used to coat the lipids, which form a coating on the micelle. The coated micelle lends acid-resistance to the formulation such that oral administration is possible with enhanced bioavailability of the nucleic acid to conditions associated with inflammation or fibrosis, such as hypertrophic myocardiopathy, heart failure with preserved ejection fraction, muscle disorders, such as muscular dystrophy, scleroderma and/or viral infection.
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
A61P 11/00 - Drugs for disorders of the respiratory system
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
6.
COMPOSITIONS COMPRISING HUMANIZED ANTIBODIES TO TNF-LIKE LIGAND 1A (TL1A) AND USES THEREOF
Described herein are humanized anti-TL1A antibodies and pharmaceutical compositions for the treatment of inflammatory bowel disease (IBD), such as Crohn's Disease (CD) and ulcerative colitis (UC).
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
A61P 1/04 - Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
7.
TL1A THERAPY COMPOSITIONS AND METHODS OF TREATMENT THEREWITH
Disclosed herein are methods, kits and compositions for treating an inflammatory disease or condition, or fibrosis in a subject that has been determined to have increased fold-change in Tumor necrosis factor (TNF)-like cytokine 1A (TL1A) expression based, at least partially, on a presence of a combination of genotypes detected in a sample obtained from the subject. In some embodiments, the combination of genotypes is significantly associated with the increased fold-change in TL1A, and in some cases, may also be predictive of severe forms of the inflammatory disease or condition. In some embodiments, the inflammatory disease or condition is an inflammatory bowel disease, such as Crohn's disease or ulcerative colitis.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
8.
METHODS AND SYSTEMS OF STRATIFYING INFLAMMATORY DISEASE PATIENTS
Described herein are methods and systems for identifying subpopulations of inflammatory bowel disease (IBD) patients utilizing genetic markers that are associated with severe Crohn's disease. Further provided are therapies useful for treating these subpopulations of IBD patients based, at least in part, on the genetic markers provided herein.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
Provided are methods, systems, and kits for selecting a subject for treatment with an inhibitor of Tumor necrosis factor-like cytokine 1A (TL1A) activity or expression based on a presence of one or more genotypes associated with a positive therapeutic response to the inhibitor of TL1A. Also provided are methods, systems and kits for detecting the one or more genotypes described herein.
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
10.
MICROBIOME-DERIVED GASEOUS SAMPLE COLLECTION SYSTEM AND METHODS
B01J 4/00 - Feed devices; Feed or outlet control devices
B32B 7/035 - Layered products characterised by the relation between layers; Layered products characterised by the relative orientation of features between layers, or by the relative values of a measurable parameter between layers, i.e. products comprising layers having different physical, chemical or physicochemical propert; Layered products characterised by the interconnection of layers with respect to the orientation of features using arrangements of stretched films, e.g. of mono-axially stretched films arranged alternately
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
G16H 10/40 - ICT specially adapted for the handling or processing of patient-related medical or healthcare data for data related to laboratory analysis, e.g. patient specimen analysis
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
G16H 70/60 - ICT specially adapted for the handling or processing of medical references relating to pathologies
G16B 20/20 - Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
G16B 40/00 - ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
12.
COMPOSITIONS AND METHODS FOR THERAPEUTIC MANAGEMENT OF HEART FAILURE PATIENTS
Disclosed herein are systems and methods for management and administration of therapeutic treatment regimens for heart failure patients. In some examples, this includes monitoring a patient's heart rate and electrocardiogram using a wearable heart rate sensor to provide input into a decision tree model to provide an effective treatment regimen. Furthermore, regular blood pressure measurements may be input into the model. The system may additionally iterate through various heart failure therapeutics based on a patient's response to prior administered therapeutics.
Methods and systems one or more for performing intra-luminal ultraviolet therapy for treating and/or ameliorating a gastrointestinal tract inflammation and/or infection are provided. In one example, a light delivery catheter may include a light emitting portion and non-illuminating portion, wherein the light emitting portion may include one or more UV transparent balloons. In some examples, the UV light source is configured to emit narrow-band light having wavelengths in a range between 335 nm and 349 nm.
A61B 1/06 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor with illuminating arrangements
A61B 18/18 - Surgical instruments, devices or methods for transferring non-mechanical forms of energy to or from the body by applying electromagnetic radiation, e.g. microwaves
A61B 18/24 - Surgical instruments, devices or methods for transferring non-mechanical forms of energy to or from the body by applying electromagnetic radiation, e.g. microwaves using laser the beam being directed along or through a flexible conduit, e.g. an optical fibre; Hand-pieces therefor with a catheter
A method for performing magnetic resonance imaging on a subject comprises: injecting a contrast agent into a region of interest of the subject; applying a pulse sequence to the region of interest; collecting auxiliary data for the region of interest, the auxiliary data being related to one or more time-varying parameters of the subject within the region of interest; determining a temporal factor F from the auxiliary data; collecting imaging data for the region of interest, the imaging data being related to one or more spatially-varying parameters of the subject within the region of interest; determining a spatial factor Ur from the imaging data; modeling a multi-dimensional image sequence as I=UrF; and deriving at least a first metric and a second metric from the multi-dimensional image sequence I, the first metric and the second metric being associated with distinct perfusion-based imaging techniques.
G01R 33/563 - Image enhancement or correction, e.g. subtraction or averaging techniques of moving material, e.g. flow-contrast angiography
A61B 5/055 - Detecting, measuring or recording for diagnosis by means of electric currents or magnetic fields; Measuring using microwaves or radio waves involving electronic [EMR] or nuclear [NMR] magnetic resonance, e.g. magnetic resonance imaging
G01R 33/465 - NMR spectroscopy applied to biological material, e.g. in vitro testing
G01R 33/56 - Image enhancement or correction, e.g. subtraction or averaging techniques
15.
TREATMENTS FOR A SUB-POPULATION OF INFLAMMATORY BOWEL DISEASE PATIENTS
Described herein are methods and systems for identifying subpopulations of patients having Crohn's disease, including populations at risk of developing stricturing or other severe disease, and populations susceptible to success or failure with surgical intervention. Further provided are therapies useful for treating subpopulations of patients having Crohn's disease.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
16.
METHODS AND SYSTEMS FOR MEASURING POST-OPERATIVE DISEASE RECURRENCE
Described herein are methods, systems, compositions, and kits useful for identifying patients as having a high likelihood of recurrence of a disease or condition affecting the gastrointestinal tract following surgical treatment of the disease or condition. The present disclosure relates to methods and systems for identifying and stratifying patients, suitable for treatment with a modulator of RNASET2, as described herein.
Devices based on semi-quantitative "sandwich" lateral flow immunoassay and methods of using the devices are provided to determine the presence and estimate the quantity of Flt-1 protein found in the plasma, serum, whole blood, saliva, urine or another bodily fluid of pregnant women in order to predict or screen for the risk of preeclampsia in pregnant women. Assays based on the devices are also provided.
A method for performing real-time magnetic resonance (MR) imaging on a subject is disclosed. A prep pulse sequence is applied to the subject to obtain a high-quality special subspace, and a direct linear mapping from k-space training data to subspace coordinates. A live pulse sequence is then applied to the subject. During the live pulse sequence, real-time images are constructed using a fast matrix multiplication procedure on a single instance of the k-space training readout (e.g., a single k-space line or trajectory), which can be acquired at a high temporal rate.
A61B 5/055 - Detecting, measuring or recording for diagnosis by means of electric currents or magnetic fields; Measuring using microwaves or radio waves involving electronic [EMR] or nuclear [NMR] magnetic resonance, e.g. magnetic resonance imaging
The present disclosure provides methods and systems of identifying a fibrotic disease in a subject using a DeepLearning model. The DeepLearning model may be used to predict, treat, monitor, and/or prevent the fibrotic disease in the subject, as well as to characterize a subtype of the fibrotic disease.
Methods of treating a subject with myocardial infarction are provided, which include selective targeting time-dependent iron products at different phases of the infarction. It is discovered that during acute phase of myocardial infarction, ferrous iron in the form of heme accumulate, often followed by infarct expansion, and during the chronic phase, ferric iron in the form of crystals are dominant. Chelator agents specific for ferrous iron, heme or ferric iron are demonstrated in the protection of cardiomyocytes, reduction of infarct expansion, or improving cardiac remodeling following myocardial infarction. Also provided are methods for determining the presence of intramyocardial hemorrhage by measuring plasma level of cardiac troponin before and after re-vascularization or a reperfusion therapy, which can be used to guide therapeutic treatment or intervention procedures to control the hemorrhage and mitigate infarct expansion.
A61B 5/02 - Measuring pulse, heart rate, blood pressure or blood flow; Combined pulse/heart-rate/blood pressure determination; Evaluating a cardiovascular condition not otherwise provided for, e.g. using combinations of techniques provided for in this group with electrocardiography; Heart catheters for measuring blood pressure
A UV light delivery device for performing intra-corporeal ultraviolet therapy is provided. The device includes an elongated body separating a proximal end and a distal end. The device also includes a UV light source configured to be received at the receiving space and a cooling tube. In some examples, the UV light source is configured to emit light with wavelengths with a desired intensity between 320 nm and 410 nm and is utilized in conjunction with an endotracheal tube or a nasopharyngeal airway.
A61B 1/06 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor with illuminating arrangements
A61B 1/267 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor for the respiratory tract, e.g. laryngoscopes, bronchoscopes
Deoxyhemoglobin in a subject may be modulated to act as a contrast agent for use in magnetic resonance imaging. Sequential gas delivery may be applied to adjust the level of deoxyhemoglobin in the subject. A suitable magnetic resonance imaging (MRI) pulse sequence that is sensitive to magnetic field inhomogeneities, such as a blood-oxygen-level dependent (BOLD) sequence, may be used to detect deoxyhemoglobin as a contrast agent.
A61B 10/00 - Other methods or instruments for diagnosis, e.g. for vaccination diagnosis; Sex determination; Ovulation-period determination; Throat striking implements
A61B 5/055 - Detecting, measuring or recording for diagnosis by means of electric currents or magnetic fields; Measuring using microwaves or radio waves involving electronic [EMR] or nuclear [NMR] magnetic resonance, e.g. magnetic resonance imaging
Systems and methods have been developed for implementation of a breath testing system for convenient sampling of intestinal gases exhaled from a patient's breath. This may include a system with a manifold that includes thermal regulation components, for instance thermistors and resistive heating elements, which maintain the temperature of the gases above the body temperature of the patient. In some examples, the system will determine an indication of whether a patient has SIBO by adjusting a change in exhaled hydrogen concentration by a methane level exhaled by a patient.
The present invention describes methods for treating idiopathic short stature. Described herein are also methods of increasing a subject's height. The methods involve administering an effective amount of a pan FGFR inhibitor or a selective FGFR inhibitor to the subject. An example of an FGRF inhibitor used in the methods described herein is erdafitinib.
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
A61K 47/54 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
C07C 275/16 - Derivatives of urea, i.e. compounds containing any of the groups the nitrogen atoms not being part of nitro or nitroso groups having nitrogen atoms of urea groups bound to acyclic carbon atoms of an acyclic and saturated carbon skeleton being further substituted by carboxyl groups
25.
COMPOSITIONS AND METHODS FOR TREATING DISEASES AND CONDITIONS BY DEPLETION OF MITOCHONDRIAL OR GENOMIC DNA FROM CIRCULATION
The present invention describes proteins that are capable to binding to mtDNA and/or gDNA and depleting circulating mtDNA and/or gDNA from a subject in need thereof. These proteins can be used to treat diseases and conditions such as cancer, cardiac infarction, and traumatic brain injury. These proteins can also be used to detect and measure circulating mtDNA and gDNA.
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
26.
PREDICTING EXTRAINTESTINAL MANIFESTATIONS OF INFLAMMATORY BOWEL DISEASE
Provided are methods, systems, and kits for identifying a patient who has or has a likelihood of developing an extra-intestinal manifestation of inflammatory bowel disease.
C12Q 1/6827 - Hybridisation assays for detection of mutation or polymorphism
A61P 1/04 - Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
A61P 1/06 - Anti-spasmodics, e.g. drugs for colics, esophagic dyskinesia
BOARD OF SUPERVISORS OF LOUISIANA STATE UNIVERSITY AND AGRICULTURAL AND MECHANICAL COLLEGE (USA)
Inventor
Dharmakumar, Rohan
Francis, Joseph
Abstract
The invention relates to methods of cardiovascular imaging and/or measurement of blood markers for detecting, diagnosing and/or prognosing cardiac or myocardial microbleeds, especially in subject with hypertension and cardiovascular diseases. Treatment methods are also provided for subjects identified, diagnosed, prognosed, or detected with cardiac or myocardial microbleeds. In some embodiments, the subject has hypertension-induced microbleeds, but has not had a myocardial infarction or reperfusion therapy.
Described herein is the production neural progenitor cell lines (NPCs) derived from human induced pluripotent stem cells (iPSCs). These iPSC-derived NPCs engraft efficiently into the spinal cord of ALS animal models and provide neuroprotection to diseased motor neurons, similar to the fetal-derived cells used in clinical study. Clonal lines were generated with a single copy GDNF construct inserted in the AAVS1 safe landing site, including inducible expression of GDNF expression. These new iPSC-derived NPC lines are scalable to clinically relevant production volumes, uniformly produce GDNF, are safe, and represent a promising new combination therapy for neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS).
Described herein are humanized anti-TL1A antibodies and pharmaceutical compositions for the treatment of inflammatory bowel disease (IBD), such as Crohn's Disease (CD) and ulcerative colitis (UC).
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
A UV light delivery device for performing intra-corporeal ultraviolet therapy is provided. The device includes an elongated body separated by a proximal end and a distal end. The device also includes a UV light source configured to be received at the receiving space. In some examples, the UV light source is configured to emit light with wavelengths with significant intensity between 320 nm and 410 nm and is utilized in conjunction with an endotracheal tube or a nasopharyngeal airway.
A method for performing magnetic resonance imaging on a subject comprises obtaining undersampled imaging data, extracting one or more temporal basis functions from the imaging data, extracting one or more preliminary spatial weighting functions from the imaging data, inputting the one or more preliminary spatial weighting functions into a neural network to produce one or more final spatial weighting functions, and multiplying the one or more final spatial weighting functions by the one or more temporal basis functions to generate an image sequence. Each of the temporal basis functions corresponds to at least one time-varying dimension of the subject. Each of the preliminary spatial weighting functions corresponds to a spatially-varying dimension of the subject. Each of the final spatial weighting functions is an artifact-free estimation of the one of the one or more preliminary spatial weighting functions.
The present invention provides for methods and uses of (i) an IL-6 inhibitor or IL-6R inhibitor, or both; and (ii) CTLA-4 or CTLA-4 fusion proteins for immunosuppression and/or immunomodulation in a solid organ transplant recipient. Various embodiments of the method comprise administering an IL-6 inhibitor or IL-6R inhibitor, or both to the recipient; and administering a or CTLA-4 fusion protein such as CTLA4-Ig to the recipient and may further include administration or use of a calcineurin inhibitor.
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
33.
METHOD OF GENERATING ACTIVATED T CELLS FOR CANCER THERAPY
Described herein are methods for improving long-term allograft survival and long-term kidney function in subjects that have undergone kidney transplant. An effective amount of one or more complement component 1 esterase inhibitors is administered to the subject, resulting in long-term improvement on kidney allograft survival and function.
Described herein are donor vectors and systems for use in dual recombinase-mediated cassette exchange. Also described herein are animal models and human cells for consistent, rigorous, and facile investigation of transgene expression. Further described herein are methods of screening for therapeutic drugs using these animal models, and methods of treatment.
A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
C12N 15/90 - Stable introduction of foreign DNA into chromosome
C12Q 1/00 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
36.
TL1A PATIENT SELECTION METHODS, SYSTEMS, AND DEVICES
Provided are methods, systems, and kits for selecting a patient for treatment with a therapeutic agent based on a presence of a genotype associated with a positive therapeutic response to the therapeutic agent. The therapeutic agent, in some embodiments, is an inhibitor of TL1A activity or expression, such as for example, an anti-TL1A antibody.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
C12Q 1/6876 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
Several embodiments relate to methods of generating cells with therapeutic potency. Several embodiments relate to generating cells as a source of exosomes with therapeutic potency. The cells and exosomes with therapeutic potency are useful for repairing and/or regenerating damaged or diseased tissue, for example.
The present disclosure provides methods and systems of identifying an inflammatory disease or condition, e.g., an inflammatory bowel disease in a subject using a DeepLearning model. The DeepLearning model may be used to predict, treat, monitor, and/or prevent the inflammatory disease or condition in the subject, as well as to characterize a subtype of the inflammatory disease or condition.
A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
G16H 50/70 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for mining of medical data, e.g. analysing previous cases of other patients
G01N 33/50 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
G06F 9/06 - Arrangements for program control, e.g. control units using stored programs, i.e. using an internal store of processing equipment to receive or retain programs
G06F 9/30 - Arrangements for executing machine instructions, e.g. instruction decode
39.
COMPOSITIONS AND METHODS TO TREAT GASTROINTESTINAL DISEASES AND DISORDERS
Described herein are compositions and methods of treating gastrointestinal diseases and disorders such as irritable bowel syndrome and small intestinal bacterial overgrowth.
Described herein are methods, systems, compositions, and kits useful for the diagnosis and/or treatment of a disease or condition in a subject. The present disclosure relates to methods and systems for identifying and stratifying patients suitable for treatment with a SKAP2 modulator, as described herein.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
Described herein are methods, systems, compositions, and kits useful for the diagnosis and/or treatment of a disease or condition in a subject. The present disclosure relates to methods and systems for identifying and stratifying patients suitable for treatment with an IL18R1 modulator, as described herein.
Described herein are methods, systems, compositions, and kits useful for the diagnosis and/or treatment of inflammatory bowel diseases, including Crohn's disease and ulcerative colitis in a subject, with an antagonist of RIPK2 activity or expression. The present disclosure relates to methods and systems for identifying and stratifying patients suitable for treatment with the antagonist to RIPK2 activity or expression, as described herein.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
C12Q 1/6809 - Methods for determination or identification of nucleic acids involving differential detection
A61K 31/395 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
A61K 31/5025 - Pyridazines; Hydrogenated pyridazines ortho- or peri-condensed with heterocyclic ring systems
A61K 31/517 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
A61K 31/519 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
C12Q 1/48 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
C12Q 1/68 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
43.
CLAZAKIZUMAB IN THE TREATMENT OF CHRONIC ANTIBODY-MEDIATED REJECTION OF ORGAN TRANSPLANT
Described herein are methods for treating antibody mediated rejection (ABMR), especially chronic active ABMR (cABMR), of transplanted organs using clazakizumab. Human kidney transplant recipients with biopsy-proven cABMR, transplant glomerulopathy and who are donor-specific antibody positive showed stabilization of renal function and lowered DSA levels following clazakizumab treatment. The estimated glomerular filtration rate of the patients at six, 12 or even 18 months were stabilized, inflammatory markers of cABMR were reduced or stabilized, and inflammatory blood markers were reduced, since clazakizumab treatment.
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
44.
RNASET2 COMPOSITIONS AND METHODS OF TREATMENT THEREWITH
Described herein are methods, systems, compositions, and kits useful for the diagnosis and/or treatment of a disease or condition in a subject. The present disclosure relates to methods and systems for identifying and stratifying patients suitable for treatment with a modulator of RNASET2, as described herein.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
C12Q 1/6876 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
Described herein are methods and systems for identifying subpopulations of patients having Crohn´s disease, including populations at risk of developing structuring or other severe disease, and populations susceptible to success or failure with surgical intervention. Further provided are therapies useful for treating subpopulations of patients having Crohn´s disease.
G01N 33/50 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
G16B 20/00 - ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
46.
USE OF CLAZAKIZUMAB TO DESENSITIZE AND IMPROVE RENAL TRANSPLANTATION IN HLA-SENSITIZED PATIENTS
Methods for desensitization of patients in need of organ transplant are provided. Human leukocyte antigen-sensitized patients awaiting incompatible kidney transplant have been treated with clazakizumab to show reduced or eliminated levels of donor-specific antibodies and an improved transplant rate. Clazakizumab and variants are provided for use in various embodiments of the methods. In some embodiments, clazakizumab, or its variants, is administered simultaneously or sequentially with intravenous immunoglobulin.
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
A61P 37/06 - Immunosuppressants, e.g. drugs for graft rejection
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
C07K 16/44 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material not provided for elsewhere
47.
STORAGE, DISPLAY, AND ANALYSIS OF FACTORED MULTIDIMENSIONAL IMAGES
A method of analyzing a multidimensional image tensor containing a plurality of images comprises: performing imaging scans of a subject to obtain imaging data; generating the multidimensional image tensor from the imaging data; determining a spatial basis tensor containing basis images based on the multidimensional image tensor; determining a temporal basis tensor containing basis functions for a temporal dimension based on the multidimensional image tensor; determining a core tensor that relates the spatial basis tensor to the temporal basis tensor; pre-multiplying the core tensor and the temporal basis tensor to produce a modified temporal basis tensor; storing the spatial basis tensor and the modified temporal basis tensor; and generating an image by multiplying at least (i) at least a portion of the spatial basis tensor and (ii) at least a portion of the modified temporal basis tensor.
G01R 33/56 - Image enhancement or correction, e.g. subtraction or averaging techniques
A61B 5/055 - Detecting, measuring or recording for diagnosis by means of electric currents or magnetic fields; Measuring using microwaves or radio waves involving electronic [EMR] or nuclear [NMR] magnetic resonance, e.g. magnetic resonance imaging
48.
COMPOSITIONS AND METHODS FOR TREATING CANCER AND AUTOIMMUNE DISEASES
A61K 31/341 - Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide not condensed with another ring, e.g. ranitidine, furosemide, bufetolol, muscarine
A61K 31/165 - Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
A61P 29/00 - Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
Disclosed herein are methods, kits and compositions for treating an inflammatory disease. These methods, kits and compositions may be particularly useful for subjects carrying a risk genotype and/or expressing a transcriptomic risk signature that is indicative of severe inflammatory disease phenotypes for which existing treatment options are limited.
C12Q 1/68 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
C12Q 1/6809 - Methods for determination or identification of nucleic acids involving differential detection
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
50.
METHODS AND SYSTEMS FOR SELECTION AND TREATMENT OF PATIENTS WITH INFLAMMATORY DISEASES
Described herein are methods and systems for identifying subjects suitable for treatment with an inhibitor of CD30L activity or expression, such as an anti-CD30L antibody. Methods and systems disclosed herein identify subjects suitable for treatment based on a presence of a genotype that is indicative of a disease or condition in the subject for which an inhibitor of CD30L is a suitable treatment. Exemplary conditions include both Crohns disease and primary sclerosing cholangitis. Compositions used to detect the genotypes described herein, and methods of using them are also provided.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
A61P 1/00 - Drugs for disorders of the alimentary tract or the digestive system
A61P 29/00 - Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
51.
HIGHLY-TIME RESOLVED MYOCARDIAL BLOOD-OXYGEN-LEVEL-DEPENDENT MAGNETIC RESONANCE IMAGING
The invention provides various methods for imaging a subject's cardiovascular system. The imaging methods may be used to diagnose or prognose various cardiovascular diseases in the subject, without contrast agents or radioactive tracers.
The present disclosure describes methods, devices and systems of diagnosing, prognosing, and treating subjects with moderate to severe forms of Crohn's disease (CD) that is characterized by stricturing and internal penetrating disease phenotypes. Also described are methods and kits for characterizing a subtype of CD, and identifying a subject as being suitable for a therapy to treat the CD.
C07H 21/04 - Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
C12Q 1/68 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
C40B 30/04 - Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
G01N 33/50 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
Described herein are humanized anti-TL1A antibodies and pharmaceutical compositions for the treatment of inflammatory bowel disease (IBD), such as Crohns Disease (CD) and ulcerative colitis (UC).
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
A61P 1/00 - Drugs for disorders of the alimentary tract or the digestive system
C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
Delivery of glial cell line-derived neurotrophic factor (GDNF) has provided benefits to Parkinsonian patients and is currently being tested in a Phase 1/2a clinical trial for ALS patients. However, chronic trophic factor delivery prohibits dose adjustment or shut off in the event of side effects. To address this, the Inventors engineered a stably integrating, third-generation doxycycline-regulated vector, allowing inducible and reversible expression of a therapeutic molecule. Human iPSC-derived neural progenitors were stably transfected with the vector, expanded and transplanted into the adult mouse brain. The Inventors observed that the addition and withdrawal of doxycycline led to GDNF expression that could be induced and reversed multiple times, demonstrating that doxycycline can penetrate the graft and regulate transgene expression in vivo. The Inventors' findings provide a proof of concept for combining gene and stem cell therapy for effective modulation of ectopic protein expression in transplanted cells.
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
Methods and systems for diagnosing, providing prophylaxis, and treating one or more age-related neurodegeneration or pathological cognitive impairment are provided. Provided are methods to protect against and/or reduce the severity of cognitive decline in an at risk elderly subject, a mild cognitive impaired subject, and/or a subject with neurodegenerative disease, comprising administering an inhibitor of CD103, an inhibitor of the effector molecules of CD8+ resident memory T cells, and/or a tolerogenic vaccine. Provided is a method for identifying subjects susceptible to or experiencing age-related neurodegeneration, comprising detecting increased levels of CD103+ resident memory T cells. A kit is provided for collecting and quantifying CD103+ CD8+ resident memory T cells.
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
G01N 33/68 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
56.
ACTIVATION-INDUCED TISSUE-EFFECTOR CELLS SUITABLE FOR CELL THERAPY AND EXTRACELLUAR VESICLES DERIVED THEREFROM
The present invention provides a method of inducing activation of a non-potent or insufficiently potent cell to convert the cell into a tissue-effector cell, thereby producing an activation-induced tissue-effector cell suitable for use in cell therapy - e.g., an activated specialized tissue-effector cell (ASTEC) suitable for cell therapy for a particular tissue type. The present invention further provides activation-induced tissue-effector cells produced thereby, as well as extracellular vesicles, e.g., exosomes, derived therefrom (e.g., ASTEX). The present invention further provides a method of improving the efficacy of a cell therapy by converting non-potent or insufficiently potent cells into activation-induced tissue-effector cells having increased potency suitable for cell therapy. The present invention further provides a method for treating a disease or condition amenable to cell therapy in a subject in need thereof, the method comprising administering a therapeutically effective amount of activation-induced tissue-effector cells or extracellular vesicles derived therefrom.
C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
C12N 5/077 - Mesenchymal cells, e.g. bone cells, cartilage cells, marrow stromal cells, fat cells or muscle cells
A61P 9/00 - Drugs for disorders of the cardiovascular system
A61P 9/10 - Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
57.
USE OF ANTI-IL-6 ANTIBODY, E.G., CLAZAKIZUMAB FOR DESENSITIZATION OF SOLID ORGAN TRANSPLANT RECIPIENTS AND/OR FOR PREVENTING, STABILIZING OR REDUCING ANTIBODY MEDIATED REJECTION (ABMR)
Novel therapeutic protocols are provided relating to the use of an anti-IL-6 antibody, e.g., Clazakizumab in order to prevent, stabilize, reduce or arrest antibody mediated rejection responses in patients receiving solid organ transplants, e.g., patients receiving transplanted kidney, heart, liver, lungs, pancreas, intestines or combinations of any of the foregoing. Also novel therapeutic protocols are provided pertaining to the use of an anti-IL-6 antibody, e.g., Clazakizumab as part of a desensitization protocol for treating highly sensitized subjects waiting for and/or after allograft transplants, e.g., patients who are to receive solid organ transplants, e.g., kidney, heart, liver, lungs, pancreas, intestines, skin or combinations of any of the foregoing. The foregoing treatments may be effected in combination with one or more other immunosuppressant regimens or other desensitization procedures.
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
58.
NOVEL BIOMARKERS AND METHODS FOR DIAGNOSING AND EVALUATING TRAUMATIC BRAIN INJURY
The present disclosure relates to methods for diagnosing and evaluating a subject that has sustained or may have sustained an injury to the head, such as a traumatic brain injury (TBI). In particular, the present disclosure identifies various biomarkers, the detection and/or differential expression of which can be used to assess the presence or absence of a TBI in a subject, and can be used as a basis for diagnosing a subject as having a specific type of TBI (e.g., severe TBI or subclasses of mild TBI). The various TBI biomarkers can be detected individually or in combination and can be used as an important diagnostic, prognostic, and/or TBI risk stratification tool as part of assessing a subject's TBI status.
Described herein are methods for improving kidney function in subjects that have undergone kidney transplant. An effective amount of one or more complement component 1 esterase inhibitors is administered to the subject, resulting in long-term improvement on kidney allograft function.
Provided herein are compositions and methods for treating, inhibiting and/or reducing the severity of neuroblastoma, small cell lung cancer (SCLC), large cell neuroendocrine cancer (LCNEC), large-cell carcinoma (LCC), squamous cell carcinoma (SqCC), and/or adenocarcinoma (AC) in subjects in need thereof. The methods include providing an agent that inhibits expression or activity of ONECUT2 and administering a therapeutically effective amount of the agent so as to treat, inhibit and/or reduce the severity of neuroblastoma, small cell lung cancer (SCLC), large cell neuroendocrine cancer (LCNEC), large-cell carcinoma (LCC), squamous cell carcinoma (SqCC), and/or adenocarcinoma (AC) in the subject.
Induced pluripotent stem cell (iPSC)-based organoid technology has tremendous potential to elucidate the intestinal and colonic epithelium's role in health and disease. Described herein are methods and compositions for generation of intestinal and colonic cells from iPSCs. Derivation of iPSCs from subjected afflicted with early onset and very early onset Inflammatory Bowel Disease (IBD), serves as an excellent model for understanding disease pathogenesis.
A system and a method for identifying a patient with a threshold number of distinct ECG abnormalities. The system and the method include an ECG monitoring device; a server; a database; a network; a memory containing machine readable medium comprising a machine executable code having stored thereon instructions for identifying patients with a threshold number of distinct ECG abnormalities; and a processor coupled to the memory, the processor configured to execute the machine executable code to cause the processor to: receive an ECG data output from the ECG monitoring device; process the ECG data output to identify abnormalities in the ECG data; and analyze the abnormalities in the ECG data in order to output an indication of whether the patient has depressed LVEF, wherein the ECG monitoring device, the server, the database, the memory, and the processor are coupled to the network via communication links.
A61B 5/366 - Detecting abnormal QRS complex, e.g. widening
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
Some embodiments provide a method of treating skeletal muscular myopathy, e.g., Duchenne muscular dystrophy (DMD), with cardiosphere-derived cells (CDCs), wherein a therapeutically effective amount of CDCs is delivered to a targeted dystrophic skeletal muscle. Some embodiment enable delivery of a therapeutically effective amount of CDCs via intramuscular injection directly at a skeletal muscle or systemic administration, e.g., intravenous injection, in a single dose or multiple doses, to treat a targeted dystrophic skeletal muscle. Some embodiments provide a method for improving exercise capabilities in DMD patients. Additional embodiments relate to exosome mediated transfer of noncoding RNAs ameliorates Duchenne muscular dystrophy by restoring dystrophin in heart and skeletal muscle. Delivery of noncoding RNA species found in CDC-derived exosomes mimics the ability of CDCs and CDC-derived exosomes to increase dystrophin protein levels.
The invention relates to culturing motor neuron cells together with skeletal muscle cells in a fluidic device under conditions whereby the interaction of these cells mimic the structure and function of the neuromuscular junction (NMJ) providing a NMJ-on-chip. Good viability, formation of myo-fibers and function of skeletal muscle cells on fluidic chips allow for measurements of muscle cell contractions. Embodiments of motor neurons co-cultures with contractile myo-fibers are contemplated for use with modeling diseases affecting NMJ's, e.g. Amyotrophic lateral sclerosis (ALS).
The invention relates to culturing motor neuron cells together with skeletal muscle cells in a fluidic device under conditions whereby the interaction of these cells mimic the structure and function of the neuromuscular junction (NMJ) providing a NMJ- on-chip. Good viability, formation of myo-fibers and function of skeletal muscle cells on fluidic chips allow for measurements of muscle cell contractions. Embodiments of motor neurons co-cultures with contractile myo-fibers are contemplated for use with modeling diseases affecting NMJ's, e.g. Amyotrophic lateral sclerosis (ALS).
An endoscopic device for use in a patient's body in disclosed. The endoscopic device may include an outer sheath having a proximal end and a distal end, a suction tube inside the outer sheath, a handle coupled to the distal end of the outer sheath, and a cap on the proximal end of the outer sheath, positioned to seal the proximal end of the outer sheath, wherein the outer sheath comprises a sterile appliance, wherein the cap is structured to open in response to a force applied through the suction tube, and wherein the suction tube comprises an internal cavity.
A61B 1/00 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor
A61B 1/012 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor characterised by internal passages or accessories therefor
A61B 17/00 - Surgical instruments, devices or methods, e.g. tourniquets
A61M 1/00 - Suction or pumping devices for medical purposes; Devices for carrying-off, for treatment of, or for carrying-over, body-liquids; Drainage systems
67.
METHOD OF SCANNING AND ASSESSING LUNG AND VASCULAR HEALTH
The invention relates to a method of scanning for vascular ill health using a data set from an in vivo scan, the method including the steps of: (1) extracting blood vessel location data and blood vessel size data from the scan data set; (2) selecting a region in the extracted vessel location data; and (3) comparing the size data in the selected region to size data in a corresponding region of a normative data set to determine vascular health.
Described herein are methods of detecting levels hydrogen sulfide (H2S) to diagnose H2S positive disease or conditions. Examples of H2S positive diseases and conditions include small intestinal bacterial overgrowth, diarrhea, fatigue, bowel urgency and abdominal pain. The H2S level can guide treatments for subjects who have high levels of H2S.
The invention relates to culturing brain endothelial cells, and optionally astrocytes and neurons in a fluidic device under conditions whereby the cells mimic the structure and function of the blood brain barrier. Culture of such cells in a microfluidic device, whether alone or in combination with other cells, drives maturation and/or differentiation further than existing systems.
Described here are systems and methods for deriving both spinal motor neurons and brain microvascular endothelial cells from induced pluripotent stem cells using distinct methods and combining them in a chip format. Neurons cultured alone in chip microvolume displayed increased calcium transient function and chip-specific gene expression. When seeded with endothelial cells, interaction further enhanced neural function, elicited vascular-neural interaction, niche gene expression with enhanced in vivo-like signatures arising from the chip co-cultures. Development of novel media formulations further allow for improved readout of differentiation process, by eliminating additives that otherwise confound differentiation processes and resulting phenotypes.
Described herein are methods and compositions related to generation of induced pluripotent stem cells (iPSCs). Improved techniques for establishing highly efficient, reproducible reprogramming using non-integrating episomal plasmid vectors. Using the described reprogramming protocol, one is able to consistently reprogram non-T cells with close to 100% success from non-T cell or non-B cell sources. Further advantages include use of a defined reprogramming media E7 and using defined clinically compatible substrate recombinant human L-521. Generation of iPSCs from these blood cell sources allows for recapitulation of the entire genomic repertoire, preservation of genomic fidelity and enhanced genomic stability.
Described herein is a method of sensitizing a cancer in a subject and methods of treating, slowing the progression of, reducing the severity of, preventing the recurrence of, and/or reducing the recurrence likelihood of a cancer in a subject. The invention further provides for a method of preventing the recurrence of and/or reducing the recurrence likelihood of a cancer in a subject who has been treated with a cancer therapy.
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
The disclosed technology relates to a system for delivering UV-A/B light with a catheter to treat infectious or inflammatory disorders in a patient. While UV light in the UV-C range has traditionally been used to treat skin disorders and for focused ablation of plaques in the arteries and other targeted internal uses, it has not been developed for broader infection, inflammation or neoplasia treatment inside the human body. Here, the inventor(s) developed a system for emission of therapeutic doses of UV light via a catheter, capsule, endoscope, tube or port that can be used to manage internal infections and inflammatory conditions inside a patient
A61B 1/06 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor with illuminating arrangements
A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
A61B 18/24 - Surgical instruments, devices or methods for transferring non-mechanical forms of energy to or from the body by applying electromagnetic radiation, e.g. microwaves using laser the beam being directed along or through a flexible conduit, e.g. an optical fibre; Hand-pieces therefor with a catheter
74.
SYSTEMS AND METHODS FOR GROWTH OF INTESTINAL CELLS IN MICROFLUIDIC DEVICES
Organs-on-chips are microfluidic devices for culturing living cells in micrometer sized chambers in order to model physiological functions of tissues and organs. Engineered patterning and continuous fluid flow in these devices has allowed culturing of intestinal cells bearing physiologically relevant features and sustained exposure to bacteria while maintaining cellular viability, thereby allowing study of inflammatory bowl diseases. However, existing intestinal cells do not possess all physiologically relevant subtypes, do not possess the repertoire of genetic variations, or allow for study of other important cellular actors such as immune cells. Use of iPSC-derived epithelium, including IBD patient-specific cells, allows for superior disease modeling by capturing the multi-faceted nature of the disease.
Organs-on-chips are microfluidic devices for culturing living cells in micrometer sized chambers in order to model physiological functions of tissues and organs. Engineered patterning and continuous fluid flow in these devices has allowed culturing of intestinal cells bearing physiologically relevant features and sustained exposure to bacteria while maintaining cellular viability, thereby allowing study of inflammatory bowl diseases. However, existing intestinal cells do not possess all physiologically relevant subtypes, do not possess the repertoire of genetic variations, or allow for study of other important cellular actors such as immune cells. Use of iPSC-derived epithelium, including IBD patient-specific cells, allows for superior disease modeling by capturing the multi-faceted nature of the disease.
Described herein are donor vectors and systems for use in in vivo dual recombinase-mediated cassette exchange. Also described are animal models for consistent, rigorous, and facile investigation of transgene expression. Further described are methods of screening for therapeutic drugs using these animal models, and methods of treatment
Described herein is a method employing acoustic data from a patient's abdominal cavity to predict potential onset of postoperative ileus (POI) in patients recovering from surgery. According to one embodiment of the method, the rate of intestinal motility events, as well as the change in the rate across specific time periods, is analyzed to predict, or rule out, potential onset of POI. The current risk assessment may then be reported, and used to determine a course of treatment, such as rapidly advancing diet in low risk patients according to enhanced recovery after surgery protocols. The method can be applied at the patient's bedside by a nurse or other medical provider, and used to determine the POI risk assessment for the patient.
The invention relates to culturing brain endothelial cells, and optionally astrocytes and neurons in a fluidic device under conditions whereby the cells mimic the structure and function of the blood brain barrier. Culture of such cells in a microfluidic device, whether alone or in combination with other cells, drives maturation and/or differentiation further than existing systems.
Systems and methods have been developed for implementation of a portable SIBO testing system for convenient sampling of intestinal gases exhaled from a patient's breath. These devices rnay be in the fon-n of a hand held meter that would integrate with a smartphone or other device with an application that can record data relating to food consumed by a user. Various technologies rnay be utilized to rneasure the levels of gases exhaled by a user, which may include (1) sorbent based technology and (2) membrane based technology. In some examples, the system will determine an indication of whether a patient has SIBO by adjusting a change in exhaled hydrogen concentration by a methane level exhaled by a patient.
G01N 33/48 - Biological material, e.g. blood, urine; Haemocytometers
G01N 5/02 - Analysing materials by weighing, e.g. weighing small particles separated from a gas or liquid by absorbing or adsorbing components of a material and determining change of weight of the adsorbent, e.g. determining moisture content
G01N 33/497 - Physical analysis of biological material of gaseous biological material, e.g. breath
G01G 3/16 - Weighing apparatus characterised by the use of elastically-deformable members, e.g. spring balances wherein the weighing element is in the form of a solid body stressed by pressure or tension during weighing measuring variations of frequency of oscillations of the body
80.
APPARATUSES, SYSTEMS AND METHODS FOR CONTROLLED DELIVERY OF THERAPEUTICS AND RELATED SUBSTANCES
The present invention teaches apparatuses, systems and methods for performing a variety of medical procedures, including those involving injecting a substance into a subject. In some embodiments, the invention teaches floating cannula systems and uses thereof for injecting a substance into a subject, wherein the floating cannular is configured to slide along a longitudinal axis of a base cannula and with respect to the base cannula to accommodate movement of the subject, and stoppers on the floating cannula prevent it from moving past the ends of the base cannula. The floating cannula also has a needle attached to it, and a delivery tube connected to the hollow needle.
A61B 90/11 - Instruments, implements or accessories specially adapted for surgery or diagnosis and not covered by any of the groups , e.g. for luxation treatment or for protecting wound edges for stereotaxic surgery, e.g. frame-based stereotaxis with guides for needles or instruments, e.g. arcuate slides or ball joints
A61M 25/088 - Introducing, guiding, advancing, emplacing or holding catheters using an additional catheter, e.g. to reach relatively inaccessible places
81.
METHODS AND SYSTEMS FOR DISTINGUISHING IRRITABLE BOWEL SYNDROME FROM INFLAMMATORY BOWEL DISEASE AND CELIAC DISEASE
Described herein are methods and systems for distinguishing irritable bowel syndrome (IBS) from inflammatory bowel disease (IBD) and celiac disease. The methods and systems can utilize the detection of anti-vinculin antibodies and anti-CdtB antibodies to distinguish IBS from IBD and celiac disease. Further described are methods for selecting a therapy to treat IBS, IBD or celiac disease.
Described herein are compositions and techniques related to generation and therapeutic application of cardiosphere-derived cells (CDCs) and CDC-derived exosomes. These cells and their secreted vesicles contain a unique milieu of biological factors, including cytokines, growth factors, transcription factors, nucleic acids including non-coding nucleic acids such as microRNAs, that serve to initiate and promote many therapeutic effects. Exosomes and their "cargo" contents, such as microRNAs can favorably modulate apoptosis, inflammation and fibrosis in the injured heart. Thus, CDC-derived exosomes represent a novel "cell-free" therapeutic candidate for tissue repair.
UNITED STATES GOVERNMENT REPRESENTED BY THE DEPARTMENT OF VETERANS AFFAIRS (USA)
Inventor
Tajbakhsh, Jian
Mortazavi, Fariborz
Abstract
In certain embodiments, this application discloses methods for detecting lung cancer. The method includes characterization of cells extracted from human sputum, which is a valuable tissue surrogate and source of upper respiratory cells that become cancerous early in 5 the process of lung cancer development. The method includes the staining of extracted cells with fluorescent reporters that produce a specific pattern in the nuclei of labeled cells, which can be made visible by light microscopy. The pattern is relevant to a type of epigenetic coding of DNA known as DNA methylation, which changes in specific cells of the lung during cancer development, in comparison to normal respiratory cells.
Described herein are kits and methods for identifying the likelihood of having a food sensitivity or intolerance, and determining dietary modifications accordingly. For example, the likelihood of having sensitivities, intolerances or allergies to gluten, lactose, FODMAPs and other foods or constituents in foods is tested and calculated. Additionally, diet modifications can be determined according to the likelihood of particular sensitivities, and the effectiveness of diet modifications can be evaluated by monitoring of meals and subsequent symptoms, and evaluating the monitoring information. Through application of the methods herein, dietary intake and symptom data may be collected and aggregated to evaluate the effect or desirability of particular foods on a population of interest. The kits and methods may comprise a standardized meal set comprising meals for consumption during a testing period. The meal set may comprise meals that either lack or are enriched with a particular dietary constituent or characteristic.
G16H 20/60 - ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance relating to nutrition control, e.g. diets
G16H 10/20 - ICT specially adapted for the handling or processing of patient-related medical or healthcare data for electronic clinical trials or questionnaires
G16H 15/00 - ICT specially adapted for medical reports, e.g. generation or transmission thereof
The invention describes compounds that inhibit both HDAC and GSK3ß (i.e., HDAC/GSK3ß dual inhibitors). The invention further describes compositions containing these HDAC/GSK3ß dual inhibitors, as well as methods and kits using these HDAC/GSK3ß dual inhibitors to treat various medical conditions. The invention also provides methods and kits using a HDAC inhibitor and a GSK3ß to treat various medical conditions, and compositions containing a HDAC inhibitor and a GSK3ß. Medical conditions treatable with various embodiments of the invention include but are not limited to caners and tumors.
A61K 47/54 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
The invention relates to compositions comprising a CD4 lymphocyte depleting agent; and methods of using the compositions to treat, prevent, reduce the severity of and/or slow the progression of a condition in a subject. The invention also relates to use of combinations of a CD4 lymphocyte depleting agent and at least one additional agent to treat, prevent, reduce the severity of and/or slow the progression of a condition in a subject. The additional agent may be an immune check point inhibitor, an adoptive immune therapeutic, an immune adjuvant, or an immune modulating agent, or their combinations.
Disclosed herein are drug delivery molecules that comprise a ligand that targets a cell surface molecule; a membrane penetration domain; and a payload binding domain; and pharmaceutical compositions comprising the same. Also disclosed are methods of treating cancer, inhibiting the progression of cancer, preventing cancer metastasis, and delivering a therapeutic compound to the brain in a subject in need thereof, the methods comprising identifying a subject in need thereof; providing a composition comprising the drug delivery molecule as disclosed herein; and administering an effective amount of the composition to the subject.
C07K 14/195 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
C07K 14/47 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans from vertebrates from mammals
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
C12N 15/11 - DNA or RNA fragments; Modified forms thereof
88.
ASSESSMENT OF CORONARY HEART DISEASE WITH CARBON DIOXIDE
The invention provides methods for diagnosing coronary heart disease in a subject in need thereof comprising administering an admixture comprising CO2 to a subject to reach a predetetmined PaCO2 in the subject to induce hyperemia, monitoring vascular reactivity in the subject and diagnosing the presence or absence of coronary heart disease in the subject, wherein decreased vascular reactivity in the subject compared to a control subject is indicative of coronary heart disease. Thc invention also provides methods for increasing sensitivity and specificity of BOLD MRI.
A61B 5/02 - Measuring pulse, heart rate, blood pressure or blood flow; Combined pulse/heart-rate/blood pressure determination; Evaluating a cardiovascular condition not otherwise provided for, e.g. using combinations of techniques provided for in this group with electrocardiography; Heart catheters for measuring blood pressure
A61B 5/055 - Detecting, measuring or recording for diagnosis by means of electric currents or magnetic fields; Measuring using microwaves or radio waves involving electronic [EMR] or nuclear [NMR] magnetic resonance, e.g. magnetic resonance imaging
89.
DIAGNOSIS AND TREATMENT OF IRRITABLE BOWEL SYNDROME AND INFLAMMATORY BOWEL DISEASE
The present invention describes methods, assays, and systems of diagnosing, selecting and treating irritable bowel syndrome (IBS) based on a subject's level of anti-vinculin and anti-CdtB antibodies. IBS can be distinguished from inflammatory bowel (IBD) disease using the methods, assays, and systems described herein.
The present invention teaches minimally invasive apparatuses and methods for stabilizing and/or guiding medical instruments used in a variety of medical procedures, including (a) introducing one or more substances into a subject's body, (b) removing one or more substances from a subject's body, (c) manipulating a region of a subject's body, or (d) combinations thereof. Among the many advantages of the inventive apparatuses are their simplicity and adaptability to attach to a variety of retractors.
The invention provides systems and methods for imaging a sample. In various embodiments, the invention provides a system comprising an image sensor, a laser for emitting excitation light for an infrared or near-infrared fluorophore, a visible light source, a notch beam splitter, a notch filter, a synchronization module, an image processing unit, an image displaying unit, and light-conducting channels. In various embodiments, the present invention provides a system comprising an image sensor, a laser for emitting excitation light for an infrared or near-infrared fluorophore, a laser clean-up filter, a notch filter, a white light source, an image processing unit, an image displaying unit, and light-conducting channels. In accordance with the present invention, the image sensor can detect both visible light and infrared light.
The invention provides systems and methods for imaging a sample. In various embodiments, the invention provides a system comprising an image sensor, a laser for emitting excitation light for an infrared or near-infrared fluorophore, a visible light source, a notch beam splitter, a notch filter, a synchronization module, an image processing unit, an image displaying unit, and light-conducting channels. In various embodiments, the present invention provides a system comprising an image sensor, a laser for emitting excitation light for an infrared or near- infrared fluorophore, a laser clean-up filter, a notch filter, a white light source, an image processing unit, an image displaying unit, and light-conducting channels. In accordance with the present invention, the image sensor can detect both visible light and infrared light.
The invention described herein provides for methods and systems for determining, selecting, and/or treating diseases and conditions caused by or associated with high quantities of methanogens in a subject, or diseases and conditions caused by or associated with low quantities of methanogens in a subject. In various embodiments, a therapy to inhibit the growth of methanogens or to promote the growth of methanogens are selected and/or administered to a subject in need thereof.
A61K 31/366 - Lactones having six-membered rings, e.g. delta-lactones
A61K 31/40 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
A61K 31/403 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
A61K 31/405 - Indole-alkanecarboxylic acids; Derivatives thereof, e.g. tryptophan, indomethacin
A61K 31/437 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
A61K 31/445 - Non-condensed piperidines, e.g. piperocaine
A61K 31/454 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
A61K 31/4985 - Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems
A61K 31/505 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
A61K 31/513 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
A61K 31/522 - Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
A61K 31/55 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
A61K 31/702 - Oligosaccharides, i.e. having three to five saccharide radicals attached to each other by glycosidic linkages
A61K 31/7028 - Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
A61K 31/7036 - Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin having at least one amino group directly attached to the carbocyclic ring, e.g. streptomycin, gentamycin, amikacin, validamycin, fortimicins
A61K 31/7048 - Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin
C12Q 1/04 - Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
C12Q 1/68 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
G01N 33/48 - Biological material, e.g. blood, urine; Haemocytometers
G01N 33/50 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
94.
DIAGNOSIS AND TREATMENT OF MOTILITY DISORDERS OF THE GUT AND BLADDER, AND OF FIBROMYALGIA
Described herein are methods and systems for the detection of anti-vinculin antibodies, for determining a presence or likely presence of a gastrointestinal motility disorder, bladder motility disorder, or fibromyalgia. Further provided are methods of selecting and/or administering a therapy based on the presence or absence of anti-vinculin antibodies.
Several embodiments relate to methods of repairing and/or regenerating damaged or diseased tissue comprising administering to the damaged or diseased tissues compositions comprising exosomes. In several embodiments, the exosomes comprise one or more microRNA that result in alterations in gene or protein expression, which in turn result in improved cell or tissue viability and/or function.
C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
C12N 5/077 - Mesenchymal cells, e.g. bone cells, cartilage cells, marrow stromal cells, fat cells or muscle cells
C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
A61K 9/00 - Medicinal preparations characterised by special physical form
A61K 31/7105 - Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
A61P 9/00 - Drugs for disorders of the cardiovascular system
C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
96.
ASSESSMENT OF CORONARY HEART DISEASE WITH CARBON DIOXIDE
The invention provides methods for diagnosing coronary heart disease in a subject in need thereof comprising administering an admixture comprising CO2 to a subject to reach a predetermined PaCO2 in the subject to induce hyperemia, monitoring vascular reactivity in the subject and diagnosing the presence or absence of coronary heart disease in the subject, wherein decreased vascular reactivity in the subject compared to a control subject is indicative of coronary heart disease. The invention also provides methods for increasing sensitivity and specificity of BOLD MRI.
The invention relates to biomarkers associated with preterm delivery. More specifically, the invention provides methods of measuring biomarkers found in women that are at risk for preterm delivery.
Methods for preventing IBS, reducing the likelihood of developing IBS and/or treating IBS by administering COT inhibitors and/or COT neutralizers to a subject in need thereof are described. Methods of eliciting a specific immune response and methods of vaccinating a subject to prevent IBS or to reduce the likelihood of developing or having IBS are also provided. Methods of diagnosing IBS by detecting the presence or absence of COT or a COT marker in a subject are described.
G01N 33/48 - Biological material, e.g. blood, urine; Haemocytometers
G01N 33/564 - Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease
C07K 14/205 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Campylobacter (G)
99.
OPTICAL METHOD FOR THE DETECTION OF ALZHEIMER'S DISEASE
The present subject matter relates to a non-invasive optical imaging method for monitoring ear-ly pathological events specific to Alzheimer's disease (AD), such as the development, amount and location of amyloid plaques. The ability to monitor such events pro-vides a basis for, among other things, AD diagnosis, prognosis and assessment of potential therapies. In addi-tion, the present subject matter introduces novel methods for treating AD and retinal ailments associated with AD. A.beta.-plaque detection in living brains is extremely limited, especially at high resolution; therefore the present inven-tion is based on studies focusing on the eyes as an alter-native to brain-derived tissue that can be imaged direct-ly, repetitively and non-invasively.
A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
A61B 6/12 - Devices for detecting or locating foreign bodies
A61F 9/00 - Methods or devices for treatment of the eyes; Devices for putting in contact-lenses; Devices to correct squinting; Apparatus to guide the blind; Protective devices for the eyes, carried on the body or in the hand
C12Q 1/00 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
patents
