Abstract

RNA interference-based methods and products for inhibiting the expression of pathogenic dynamin-1 variants are provided. Delivery vehicles such as recombinant adeno-associated viruses deliver DNAs encoding RNAs that inhibit the expression of the dynamin-1 variants. The methods treat, for example, developmental and epileptic encephalopathies.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• A61K 31/713 - Double-stranded nucleic acids or oligonucleotides
• C12N 15/86 - Viral vectors

Abstract

The invention discloses oncogenic fusion proteins. The invention provides methods for treating gene-fusion based cancers.

IPC Classes  ?

• C12N 15/62 - DNA sequences coding for fusion proteins
• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
• C07K 14/71 - ReceptorsCell surface antigensCell surface determinants for growth factorsReceptorsCell surface antigensCell surface determinants for growth regulators
• C07K 14/82 - Translation products from oncogenes
• C07K 16/18 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans
• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• C12N 9/12 - Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
• C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
• G01N 33/574 - ImmunoassayBiospecific binding assayMaterials therefor for cancer

Abstract

Truncated dominant negative forms of CEBPB and CEBPD, and cell-penetrating forms thereof are described. Methods for using the truncated dominant negative forms of CEBPB and CEBPD proteins, and cell-penetrating forms thereof, for decreasing viability of neoplastic cells and treating cancer in a subject are also described.

IPC Classes  ?

• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
• A61K 38/00 - Medicinal preparations containing peptides
• A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• A61P 35/00 - Antineoplastic agents

Abstract

System, apparatus, method and computer-accessible medium according to exemplary embodiments of the present disclosure which facilitate accessible, data-driven neuroimaging. Exemplary embodiment of the present disclosure provides for a magnet, a gradient, and spectrometer technology that can be contained in an imaging suite that can be affordably manufactured, delivered, and operated anywhere in the world by a trained field nurse. Exemplary networks of these field-deployed MR suites can be tethered to a remote resource base such as a hospital through satellite links to a cloud platform. In exemplary embodiments, massive amounts of heterogeneous data can be collected from diverse populations in a standardized way and archived for machine learning approaches to permit model-based inference generation.

IPC Classes  ?

• G01R 33/56 - Image enhancement or correction, e.g. subtraction or averaging techniques
• A61B 5/055 - Detecting, measuring or recording for diagnosis by means of electric currents or magnetic fieldsMeasuring using microwaves or radio waves involving electronic [EMR] or nuclear [NMR] magnetic resonance, e.g. magnetic resonance imaging
• G01R 33/36 - Electrical details, e.g. matching or coupling of the coil to the receiver
• G01R 33/38 - Systems for generation, homogenisation or stabilisation of the main or gradient magnetic field
• G01R 33/3815 - Systems for generation, homogenisation or stabilisation of the main or gradient magnetic field using electromagnets with superconducting coils, e.g. power supply therefor
• G01R 33/54 - Signal processing systems, e.g. using pulse sequences
• G06N 20/00 - Machine learning
• G06T 7/00 - Image analysis

Abstract

Methods and compositions that treat Alzheimer's disease and other neurodegenerative diseases and/or to ameliorate or improve symptoms associated with Alzheimer's disease. In some aspects, the compositions and methods use a serotonin 4 receptor (5-hydroxytryptamine (serotonin) receptor 4, or 5-HT4R) agonist in combination with: (R,S)-ketamine, a (R,S)-ketamine analog, or a pharmaceutically acceptable salt, derivative, or metabolite thereof; an antagonist of the glutamate N-methyl-D-aspartate (NMDA) receptor (NMDAR); or an agonist of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR).

IPC Classes  ?

• A61K 31/513 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
• A61K 9/00 - Medicinal preparations characterised by special physical form
• A61K 31/135 - Amines, e.g. amantadine having aromatic rings, e.g. methadone
• A61K 31/401 - ProlineDerivatives thereof, e.g. captopril
• A61K 31/42 - Oxazoles
• A61K 31/4245 - Oxadiazoles
• A61K 31/4525 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with oxygen as a ring hetero atom
• A61K 31/453 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with oxygen as a ring hetero atom
• A61K 31/454 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
• A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

Medical devices having engineered mechanically functional cartilage from adult human mesenchymal stem cells and method for making same.

IPC Classes  ?

• A61L 27/36 - Materials for prostheses or for coating prostheses containing ingredients of undetermined constitution or reaction products thereof
• A61F 2/30 - Joints
• A61L 27/38 - Animal cells
• A61L 27/42 - Composite materials, i.e. layered or containing one material dispersed in a matrix of the same or different material having an inorganic matrix
• A61L 27/46 - Composite materials, i.e. layered or containing one material dispersed in a matrix of the same or different material having a macromolecular matrix with phosphorus-containing inorganic fillers
• A61L 27/50 - Materials characterised by their function or physical properties
• A61L 27/56 - Porous or cellular materials

Abstract

The present disclosure provides to systems, methods, and compositions for rescuing protein misfolding and preventing protein aggregation. Particularly the present disclosure provides methods and compositions comprising DNAJB6 or variants thereof, or polynucleotides encoding DNAJB6 or variants thereof. The present disclosure also provides methods for treating protein misfolding and/or protein aggregation diseases (e.g., multiple amyotrophic lateral sclerosis and frontotemporal dementia) by administering the systems or compositions to a subject in need thereof.

IPC Classes  ?

• A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

Systemic lupus erythematosus (SLE) can be diagnosed by affixing a plurality of light sources and a plurality of light detectors against the subject's body near a joint, and sequentially transmitting light from each of the plurality of light sources into the subject's body. Signals are acquired from each of the plurality of light detectors. The rise time of the acquired signals that occurs in response to an inflation of a pressure cuff is determined, and an indication of whether the joint is affected by SLE is made based on the determined rise time. In some embodiments, a plateau time of the acquired signals is also acquired, and the indication of whether the joint is affected by SLE is made based on the determined rise time and the determined plateau time.

IPC Classes  ?

• A61B 5/00 - Measuring for diagnostic purposes Identification of persons
• A61B 5/026 - Measuring blood flow

Abstract

Systems and methods for performing non-destructive sensing of a cell or tissue, in vivo or in culture, are provided. The disclosed systems and methods include fabricating and powering one or more implantable integrated circuit (IC) chips that include a network of Photovoltaic (PV) cells for energy harvesting from an optical energy source, an optical modulator integrating Quantum Dot capacitors (QD-caps) for optical data transfer using fluorescence modulation, and sensing circuitry. The IC chip disclosed herein can measure a thickness of around 10 μm, allowing injection into small cells and diffusion through tissue, it is powered and imaged under a microscope and communicates using fluorescence modulation imaged under a microscope.

IPC Classes  ?

• G01N 21/64 - FluorescencePhosphorescence
• A61B 5/00 - Measuring for diagnostic purposes Identification of persons
• G02F 1/015 - Devices or arrangements for the control of the intensity, colour, phase, polarisation or direction of light arriving from an independent light source, e.g. switching, gating or modulatingNon-linear optics for the control of the intensity, phase, polarisation or colour based on semiconductor elements having potential barriers, e.g. having a PN or PIN junction
• G02F 1/025 - Devices or arrangements for the control of the intensity, colour, phase, polarisation or direction of light arriving from an independent light source, e.g. switching, gating or modulatingNon-linear optics for the control of the intensity, phase, polarisation or colour based on semiconductor elements having potential barriers, e.g. having a PN or PIN junction in an optical waveguide structure
• H10F 77/40 - Optical elements or arrangements

Abstract

Treatment of females that experience social isolation-induced anxiety includes administration of an agent that blocks or reduces AVPR1A signaling in the subject. Such agents may interfere with AVPR1A in the amygdala, or specifically in the central nucleus of the amygdala (CeA). Treatment may be administered by injection or by chemogenetic approaches. Compounds that block AVPR1A signaling may be used to accomplish such treatment. Useful compounds include, for example, AVPR1A antagonists such as SRX246.

IPC Classes  ?

• A61K 31/4545 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
• A61P 25/22 - Anxiolytics

Abstract

Provided here are methods to prevent, inhibit or treat an autoimmune disease or a vascular or cardiovascular disorder in a mammal, comprising administering to the mammal a composition comprising an effective amount of isolated nucleic acid comprising a nucleotide sequence encoding WDFY3/Alfy or a portion thereof, a nucleotide sequence comprising a WDFY3/Alfy-specific long non-coding RNA (lncRNA) or a corresponding DNA sequence, a nucleotide sequence comprising a portion of a lncRNA WDFY3-AS2 or a corresponding DNA sequence, or isolated WDFY3/Alfy or a portion thereof.

IPC Classes  ?

• A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61P 37/06 - Immunosuppressants, e.g. drugs for graft rejection

Abstract

Exemplary systems, methods, and apparatuses are provided for generating at least one periodically poled layered compound. Exemplary systems, methods, and apparatuses according to an exemplary embodiment of the present disclosure can include patterning a plurality of slabs of layered compounds and stacking the plurality of slabs with each slab twisted relative to each adjacent slab.

IPC Classes  ?

• H10H 20/814 - Bodies having reflecting means, e.g. semiconductor Bragg reflectors
• H10H 20/01 - Manufacture or treatment

Abstract

Methods for prophylactically treating a stress-induced affective disorder or stress-induced psychopathology in a subject are provided. Also provided are methods for inducing and/or enhancing stress resilience in a subject. In certain embodiments, an effective amount of (R,S)-ketamine or (2R,6R)-hydroxynorketamine ((2R,6R)-HNK) is administered to a female or male subject prior to a stressor.

IPC Classes  ?

• A61K 31/135 - Amines, e.g. amantadine having aromatic rings, e.g. methadone
• A61K 9/00 - Medicinal preparations characterised by special physical form
• A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• A61P 25/24 - Antidepressants

Abstract

One aspect of the invention provides a method of treating a cornea. The method includes controlling a light source to apply light energy pulses to a single corneal layer selected from the group consisting of: an anterior corneal layer and a posterior corneal layer. The light energy pulses are below an optical breakdown threshold for the cornea and ionize water molecules within the treated corneal layer to generate reactive oxygen species that cross-link collagen within the single corneal layer. Another aspect of the invention provides a method of treating a cornea. The method includes controlling a light source to apply light energy pulses to at least a corneal stroma layer of a cornea. The light energy pulses are below an optical breakdown threshold for the cornea and ionize water molecules within the treated corneal stromal layer to generate reactive oxygen species that cross-link collagen within the cornea.

IPC Classes  ?

• A61F 9/008 - Methods or devices for eye surgery using laser

Abstract

The disclosed matter provides a Contorted Macromolecular Ladders for Fast-charging and Long-Life Lithium Batteries, and the method thereof. By tuning the length of hPDI[n], the electrical and ionic conductivity of the resulting contorted macromolecular ladders can be modulated for improving the lithium-ion coordination and transport. The materials can be applied into organic battery electrode materials which are sustainable, fast-charging, and long lasting.

IPC Classes  ?

• H01M 4/137 - Electrodes based on electro-active polymers
• H01M 4/02 - Electrodes composed of, or comprising, active material
• H01M 10/0525 - Rocking-chair batteries, i.e. batteries with lithium insertion or intercalation in both electrodesLithium-ion batteries

Abstract

Systems and methods are provided for generating amodal images from occlusions objects in input images. Examples herein include receiving a prompt selecting an object in an input image; applying the input image to a trained conditional generative model that generates an amodal image of the selected object based on the prompt and the input image; and outputting the amodal image.

IPC Classes  ?

• G06T 11/60 - Editing figures and textCombining figures or text
• G06T 5/50 - Image enhancement or restoration using two or more images, e.g. averaging or subtraction
• G06T 5/70 - DenoisingSmoothing
• G06T 7/12 - Edge-based segmentation
• G06V 10/26 - Segmentation of patterns in the image fieldCutting or merging of image elements to establish the pattern region, e.g. clustering-based techniquesDetection of occlusion

Abstract

The present disclosure provides systems, methods, and compositions for modifying a target nucleic acid. Particularly, the present invention relates to a polypeptide comprising a single subunit of a reverse transcriptase and a sequence-specific nuclease for use in prime-editing modification of a nucleic acid.

IPC Classes  ?

• C12N 15/90 - Stable introduction of foreign DNA into chromosome
• C12N 9/12 - Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof

Abstract

This disclosure to the methods for nucleic acid modification, gene targeting, and gene tagging comprising an engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated transposon (CAST) system with a donor DNA comprising at least one engineered transposon end sequence and/or at least one integration co-factor protein. More particularly, the present disclosure provides systems comprising: an engineered CAST system or one or more nucleic acids encoding the engineered CAST system, wherein the CAST system comprises at least one or all of: i) at least one Cas protein, ii) one or more transposon-associated proteins, iii) at least one guide RNA (gRNA) complementary to at least a portion of a target nucleic acid sequence; and a donor nucleic acid comprising a cargo nucleic acid sequence flanked by at least one engineered transposon end sequence and/or at least one integration co-factor protein, or a nucleic acid encoding thereof.

IPC Classes  ?

• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 9/22 - Ribonucleases
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

The present disclosure relates to novel compounds and pharmaceutical compositions thereof, and methods for promoting healthy aging of skin, the treatment of skin disorders, the treatment of cardiovascular disorders, the treatment of renal disorders, the treatment of angiogenesis disorders, such as cancer, treatment of tissue damage, such as non-cardiac tissue damage, the treatment of evolving myocardial infarction, the treatment of ischemic injury, and the treatment of various other disorders, such as complications arising from diabetes with the compounds and compositions of the invention. Other disorders can include, but are not limited to, atherosclerosis, coronary artery disease, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic cardiomyopathy, infections of the skin, peripheral vascular disease, stroke, asthma, and the like.

IPC Classes  ?

• C07D 495/04 - Ortho-condensed systems
• A61P 9/10 - Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
• A61P 13/12 - Drugs for disorders of the urinary system of the kidneys
• A61P 17/00 - Drugs for dermatological disorders
• A61P 25/02 - Drugs for disorders of the nervous system for peripheral neuropathies

Abstract

Training neural network(s) (NN(s)) to solve optimization problem (OP) includes: configuring a first NN of the NN(s) with a first set of (FSO) values for NN parameters (NNPs); selecting a FSO training samples (TSs) for training the NN(s); providing the FSO TSs and a FSO first variables to the first NN to produce a FSO first output variables (OVs); evaluating an OP-performance-measuring objective function (OF) based on the FSO TSs and the FSO first OVs to provide a first value of (VO) a performance metric (FVOPM) of the NN(s); updating the NNPs based on the FVOPM; selecting a second set of (SSO) TSs for training the NN(s); providing the SSO TSs and the FSO first OVs to the first NN to produce a SSO first OVs; evaluating the OF based on the SSO TSs and the SSO first OVs to provide a second VO the PM of the NN(s); and updating the NNPs based on the second VO the PM.

IPC Classes  ?

• G06N 3/08 - Learning methods

Abstract

Biological cells can be identified and recovered from a sample by pumping the sample through a flow channel so that the sample flows through the flow channel with a non-turbulent flow (e.g., a laminar flow). A plurality of images of the sample are captured as the sample passes through the flow channel. These images are analyzed to determine which portions of the sample include a target biological cell. Portions of the sample that were determined to include a target biological cell are routed into at least one first container, and portions of the sample that were not determined to include a target biological cell are routed to at least one second destination (e.g., one or more second containers).

IPC Classes  ?

• G01N 15/14 - Optical investigation techniques, e.g. flow cytometry
• B01L 3/00 - Containers or dishes for laboratory use, e.g. laboratory glasswareDroppers
• G01N 15/10 - Investigating individual particles
• G01N 15/1434 - Optical arrangements
• G01N 15/149 - Optical investigation techniques, e.g. flow cytometry specially adapted for sorting particles, e.g. by their size or optical properties
• G06V 10/82 - Arrangements for image or video recognition or understanding using pattern recognition or machine learning using neural networks
• G06V 20/69 - Microscopic objects, e.g. biological cells or cellular parts

Abstract

The present disclosure provides to systems, methods, and compositions for template-based DNA, synthesis. Particularly the present disclosure provides systems, methods, and compositions for generating multi-site (e.g., three or more) sequence variants of template nucleic acid strands kilobases (e.g., greater than Ikb) m length.

IPC Classes  ?

• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C07K 14/005 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from viruses
• C12N 15/86 - Viral vectors

Abstract

The bio-microbur therapeutic delivery platform is a three-dimensional (3D)-oriented nanoneedle platform shaped like a microscale version of a fruit bur. The bio-microbur may be used for drug delivery and other biological applications, including without limitation delivery of oral vaccines or other oral biologics. Similar to a fruit bur's ability to adhere to different surfaces, the bio-microbur therapeutic delivery platform adheres to biological tissue, cell membranes, and biological gels. The bio-microbur therapeutic delivery platform includes a core and a plurality of nanoneedles secured to the core and extending outwardly therefrom, adapted for carrying and delivering a therapeutic agent. The treating agent may be an SSRI, such as fluoxetine.

IPC Classes  ?

• A61K 9/00 - Medicinal preparations characterised by special physical form
• A61K 9/51 - Nanocapsules

Abstract

An insulated heating-unit cover having an opening to permit air to circulate around the heating-source when a vent disposed at the top of the cover is opened, allowing heat into a space. The cover can include a heating-unit temperature sensor disposed within a space covered by the cover and a controller in wireless communication with a space temperature sensor located at a distance away from the heating-unit. The controller can be configured to operate an actuator such that the vent is open when the space temperature sensor indicates that the ambient temperature is below a set point temperature and such that the vent is closed when the ambient temperature is greater than the set point temperature. The controller can communicate with a plurality of other similar controllers and a central server to effect changes in the output of a central heating source coupled to a plurality of individual heating-units.

IPC Classes  ?

• G09F 15/00 - Boards, hoardings, pillars, or like structures for notices, placards, posters, or the like
• F24D 19/00 - DOMESTIC- OR SPACE-HEATING SYSTEMS, e.g. CENTRAL HEATING SYSTEMSDOMESTIC HOT-WATER SUPPLY SYSTEMSELEMENTS OR COMPONENTS THEREFOR Details
• F24D 19/06 - Casings, cover lids or ornamental panels, for radiators
• F24D 19/10 - Arrangement or mounting of control or safety devices
• F24F 11/30 - Control or safety arrangements for purposes related to the operation of the system, e.g. for safety or monitoring
• F24F 11/38 - Failure diagnosis
• F24F 11/46 - Improving electric energy efficiency or saving
• F24F 11/52 - Indication arrangements, e.g. displays
• F24F 11/58 - Remote control using Internet communication
• F24F 11/63 - Electronic processing
• F24F 11/77 - Control systems characterised by their outputsConstructional details thereof for controlling the supply of treated air, e.g. its pressure for controlling air flow rate or air velocity by controlling the speed of ventilators
• F24F 110/10 - Temperature
• F24F 130/00 - Control inputs relating to environmental factors not covered by group
• F24F 130/10 - Weather information or forecasts
• G05D 23/19 - Control of temperature characterised by the use of electric means
• G09F 7/14 - Constructional features of the symbol-bearing or -forming elements
• G09F 7/18 - Means for attaching signs, plates, panels, or boards to a supporting structure

Abstract

The subject matter described here relates to an enhancer specific to a subset of cholinergic neurons, that can control gene expression in a highly neuron-specific manner, wherein the enhancer is compatible with AAVs packaging and can induce gene expression or knockdown in cholinergic neurons in both post-natal and adult subjects.

IPC Classes  ?

• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• C12N 15/86 - Viral vectors

Abstract

Orally-deliverable programmable bacteria cells that colonize colorectal tumors and produce diagnostic and therapeutic molecules, as well as related compositions and methods.

IPC Classes  ?

• A61K 35/741 - Probiotics
• A61K 35/00 - Medicinal preparations containing materials or reaction products thereof with undetermined constitution
• A61P 35/00 - Antineoplastic agents
• C07K 14/535 - Granulocyte CSFGranulocyte-macrophage CSF
• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• C12N 15/70 - Vectors or expression systems specially adapted for E. coli
• G01N 33/53 - ImmunoassayBiospecific binding assayMaterials therefor
• G01N 33/574 - ImmunoassayBiospecific binding assayMaterials therefor for cancer

Abstract

Phonon engineered, lanthanide doped upconverting nanoparticles with very low phonon energies and tunable methods of synthesis that adjust OA:OM ratio and reaction temperature are provided. Low phonon energy KPb2X5 (X=Cl, Br) upconverting nanoparticles, both doped and undoped, exhibit dramatically suppressed multiphonon relaxation, enhancing upconversion emission from higher lanthanide excited states and enabling room temperature observation of avalanche like upconversion by Nd3+ ions. Intrinsic optical bistability (IOB) of the materials can provide bit level functionality to all optical computing. The IOB of Nd3+ doped nanocrystals, which are either bright or dark at the same excitation power based on power history, illustrate the functionality. High contrast switching and IOB are enabled via the photon avalanche process, which sustains population inversion between the ground and the first excited 4fN states of Nd3+ ions. The IOB of these nanocrystals can be controlled by temporal pump modulation and can store information.

IPC Classes  ?

• C09K 11/77 - Luminescent, e.g. electroluminescent, chemiluminescent, materials containing inorganic luminescent materials containing rare earth metals
• C01F 17/36 - Compounds containing rare earth metals and at least one element other than a rare earth metal, oxygen or hydrogen, e.g. La4S3Br6 halogen being the only anion, e.g. NaYF4
• C01G 21/00 - Compounds of lead

Abstract

Disclosed herein are lung progenitor cells that are in the form of lung organoids and methods of generating the lung progenitor cells. The lung organoids can be an important resource for treating lung disorders and injuries, studies in human lung regeneration, disease modeling, and drug target identification and validation.

IPC Classes  ?

• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
• A61K 35/42 - Respiratory system, e.g. lungs, bronchi or lung cells
• C12N 5/00 - Undifferentiated human, animal or plant cells, e.g. cell linesTissuesCultivation or maintenance thereofCulture media therefor
• G01N 33/50 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing

Abstract

The present invention provides a compound having the structure wherein A is a ring structure, with or without substitution; X1 is C or N; X2 is N, O, or S; Y1 is H, -(alkyl), -(alkenyl), -(alkynyl), -(cycloalkyl), (haloalkyl), -(alkyl)-O-(alkyl) or -(alkyl)-(cycloalkyl); Y 2 is H, -(alkyl), -(alkenyl), -(alkynyl), -(cycloalkyl), (haloalkyl), -(alkyl)-O-(alkyl) or -(alkyl)-(cycloalkyl); Y3 is H-(alkyl), -(alkenyl), -(alkynyl), -(cycloalkyl), (haloalkyl), -(alkyl)-O-(alkyl) or -(alkyl)-(cycloalkyl); Y 4 is H-(alkyl), -(alkenyl), -(alkynyl), -(cycloalkyl), (haloalkyl), -(alkyl)-O-(alkyl) or -(alkyl)-(cycloalkyl); Y5 is H, -(alkyl), -(alkenyl), -(alkynyl), -(cycloalkyl), (haloalkyl), -(alkyl)-O-(alkyl) or -(alkyl)-(cycloalkyl); a and P are each present or absent and when present each is a bond.

IPC Classes  ?

• C07D 491/18 - Bridged systems
• A61K 9/00 - Medicinal preparations characterised by special physical form
• A61K 9/70 - Web, sheet or filament bases
• A61K 31/485 - Morphinan derivatives, e.g. morphine, codeine
• A61K 47/38 - CelluloseDerivatives thereof
• A61P 25/04 - Centrally acting analgesics, e.g. opioids
• A61P 25/24 - Antidepressants
• C07D 471/18 - Bridged systems
• C07D 495/18 - Bridged systems

Abstract

Exemplary apparatus and method can be provided for use with ultrasound imaging. The apparatus can include at least one implantable device which is configured to communicate with an ultrasound imaging system, be located by the ultrasound imaging system using ultrasound signals generated thereby to generate a location of the implantable device(s), and transmit data to the ultrasound imaging system from the location of the implantable device(s) that was located by the ultrasound imaging system. Further, it is possible to implant, into a structure, at least one device which is responsive to ultrasound signals generated by the ultrasound imaging system, locate the device(s) within the structure by the ultrasound imaging system using the ultrasound signals to generate a location of the device(s) within the structure, and transmit data to the ultrasound imaging system from the location of the device(s) that was located by the ultrasound imaging system.

IPC Classes  ?

• A61B 8/08 - Clinical applications

Abstract

The present disclosure provides compositions and vectors comprising a transgene(s) encoding more than one isoform of Crumbs homologue-1 (CRB1) (e.g., CRB1-A and CRB1-B), and compositions thereof, for use in the treatment or prevention of CRB1-related diseases and disorder (e.g., autosomal recessive retinitis pigmentosa (RP) and Leber congenital amaurosis (LCA)).

IPC Classes  ?

• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61P 27/02 - Ophthalmic agents
• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
• C12N 15/86 - Viral vectors

Abstract

Disclosed are systems, methods, and other implementations, including a method for configuring a machine learning (ML) system. The method includes determining for a layer, l, of the ML system sets of parameters defining one or more statistical distribution models (e.g., lognormal) used for directing the ML system to an optimized configuration. The layer is connected to one or more other layers through weighted connected, and includes configurable ML elements (e.g., neurons) that can be tuned. The method also includes adjusting one or more of, a) weights of the weighted connections of the layer according to parameters defining a first distribution model, b) adjustable parameters defining the first statistical distribution model, c) ML element parameters, defining operations of at least some of the configurable ML elements, according to parameters defining a second distribution model, and/or d) adjustable parameters defining the second distribution model.

IPC Classes  ?

• G06N 3/08 - Learning methods

Abstract

A cathode active material having a polymer with helical perylene diimide (hPDI) subunits with the side-chains of the helical perylene diimide (hPDI) subunits removed and a method of manufacturing the cathode active material are provided. A rechargeable battery cell with the polymer as a cathode material, a magnesium metal anode, and an ether-based electrolyte.

IPC Classes  ?

• H01M 4/60 - Selection of substances as active materials, active masses, active liquids of organic compounds
• H01M 4/02 - Electrodes composed of, or comprising, active material
• H01M 4/38 - Selection of substances as active materials, active masses, active liquids of elements or alloys
• H01M 10/0569 - Liquid materials characterised by the solvents

Abstract

Disclosed are methods, systems, devices, and other implementations, including a voltage converter system that includes two or more Active Half Bridge (AHB) converter circuits, each of the two or more AHB converter circuits connected to one or more windings of a transformer, with each AHB converter circuit including one or more switches and one or more energy storage devices. The voltage converter system further includes one or more controllers to control electrical behavior of the two or more AHB converter circuits according to normalized switching functions representing the switching states of the switches of the two or more AHB converter circuits.

IPC Classes  ?

• H02M 3/335 - Conversion of DC power input into DC power output with intermediate conversion into AC by static converters using discharge tubes with control electrode or semiconductor devices with control electrode to produce the intermediate AC using devices of a triode or a transistor type requiring continuous application of a control signal using semiconductor devices only
• H02M 1/00 - Details of apparatus for conversion

Abstract

Provided herein are recombinant miniature swine without expression of endogenous porcine CD47 and SIRPA, but with the expression of human or humanized CD47 and human or humanized SIRPA under the same regulatory elements as the endogenous porcine CD47 and SIRPA. Also provided are cells, tissues, and organs derived from such recombinant miniature swine. Furthermore, provided herein are methods of transplanting a graft from a first donor of such recombinant miniature swine with or without bone marrow from a second donor of such recombinant miniature swine.

IPC Classes  ?

• A01K 67/0278 - Knock-in vertebrates, e.g. humanised vertebrates
• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
• C07K 14/705 - ReceptorsCell surface antigensCell surface determinants
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Disclosed are systems, methods, and other implementations, including a method for battery performance analysis and management that includes measuring voltage response data for a lithium-ion battery in response to a bipolar current pulse signal applied to the lithium-ion battery, and determining, based on the measured voltage response data, using a bipolar pulse (BIP) model resultant battery characterization data representative of linear and nonlinear behavior of the lithium-ion battery. The resultant battery characterization data can include a set of multiple parameters of an equivalent circuit representation of the BIP model.

IPC Classes  ?

• G01R 31/367 - Software therefor, e.g. for battery testing using modelling or look-up tables
• G01R 31/378 - Arrangements for testing, measuring or monitoring the electrical condition of accumulators or electric batteries, e.g. capacity or state of charge [SoC] specially adapted for the type of battery or accumulator
• G01R 31/3835 - Arrangements for monitoring battery or accumulator variables, e.g. SoC involving only voltage measurements
• G01R 31/392 - Determining battery ageing or deterioration, e.g. state of health
• H01M 10/0525 - Rocking-chair batteries, i.e. batteries with lithium insertion or intercalation in both electrodesLithium-ion batteries
• H01M 10/42 - Methods or arrangements for servicing or maintenance of secondary cells or secondary half-cells

Abstract

A modular bioreactor system is provided including a platform having a seat to receive a modular tissue chamber, and one or more platform interfacial members; and a releasable modular tissue chamber including a bottom surface, an open top, and sidewalls defining a well therein, the releasable modular tissue chamber configured to be received by the seat of the platform, the tissue chamber further including an interfacial member configured to releasably connect the modular tissue chamber to the platform, wherein a tissue chamber contains human bone marrow (engineered using iPS cell derived osteoblasts, osteoclasts, endothelial cells, supporting mesenchymal cells, and hematopoietic cells in bone matrix) infused by primary leukemia cells

IPC Classes  ?

• C12M 3/00 - Tissue, human, animal or plant cell, or virus culture apparatus
• C12M 1/12 - Apparatus for enzymology or microbiology with sterilisation, filtration, or dialysis means
• C12M 1/42 - Apparatus for the treatment of microorganisms or enzymes with electrical or wave energy, e.g. magnetism, sonic wave
• C12N 5/09 - Tumour cells

Abstract

Disclosed are systems and methods for motor control using piecewise affine modelling. An electronic controller may determine current values for a motor in a rotational reference frame. Each current value may be associated with a dimension of a set of dimensions of the rotational reference frame. The electronic controller may further determine, based on the current values, a flux linkage value for each of the set of dimensions of the rotational reference frame using a piecewise affine map. The electronic controller may further determine a target flux linkage value for each of the set of dimensions of the rotational reference frame. The electronic controller may then control a power switching network coupled between a power supply and the motor based on the flux linkage values and the target flux linkage values.

IPC Classes  ?

• H02P 21/18 - Estimation of position or speed
• H02P 21/00 - Arrangements or methods for the control of electric machines by vector control, e.g. by control of field orientation

Abstract

The present disclosure provides systems, methods, and compositions for prime-editing modification of c.828 splice site mutations in the peripherin-2 gene. Particularly the present disclosure provides systems, methods, and compositions for correcting one or more disease-causing splice site mutations selected from: c.828+3A>T, c.828+1G>A, c.828+2T>C, c.828+1G>T, and combinations thereof.

IPC Classes  ?

• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
• A61P 27/02 - Ophthalmic agents
• C12N 9/12 - Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof

Abstract

Systems and methods of performing temperature swing solvent extraction (TSSE) descaling of produced water and desalination of high-salinity brines, e.g., those having a total dissolved solids (TDS) greater than about 250,000 ppm are capable of producing descaled water products including less than about 5% weight percent TDS. The brine/produced water feedstreams and combined with a solvent having temperature-dependent water solubility at a temperature TL. Water is extracted from the feedstream into the solvent to form a water-in-solvent extract component and a raffinate component, from which a solid phase can be precipitated as more water is portioned in the solvent and basicity increases. Heating of the water-in-solvent extract component reduces the solubility of the water therein, producing a biphasic mixture of dewatered solvent and descaled water that can be separated. Because these systems and methods do not require a phase change of water, these products are achieved with significantly higher energy efficiencies when compared to evaporation-based thermal methods.

IPC Classes  ?

• C02F 1/26 - Treatment of water, waste water, or sewage by extraction
• C02F 1/04 - Treatment of water, waste water, or sewage by heating by distillation or evaporation
• C02F 1/44 - Treatment of water, waste water, or sewage by dialysis, osmosis or reverse osmosis
• C02F 1/66 - Treatment of water, waste water, or sewage by neutralisationTreatment of water, waste water, or sewage pH adjustment
• C02F 103/08 - Seawater, e.g. for desalination
• C02F 103/10 - Nature of the water, waste water, sewage or sludge to be treated from quarries or from mining activities

Abstract

PAMAM-based nanocarriers with high loading efficiency of chemotherapeutics and high cfNA binding ability enable sustained delivery of chemotherapeutics while inhibiting systemic inflammation caused by the chemotherapy. This is useful for treating both primary and metastatic tumors with attenuated cognitive impairment.

IPC Classes  ?

• A61K 31/337 - Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
• A61K 31/704 - Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin, digitoxin
• A61K 47/54 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
• A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
• A61P 35/04 - Antineoplastic agents specific for metastasis

Abstract

Disclosed are implementations, including a method for medical/clinical monitoring that includes obtaining clinical and physiological measurement data for a patient, and contextual information associated with the patient and representative of location and time at which the clinical and physiological measurement data were obtained, and obtaining clinician behavior data for the clinicians while treating the patient. The method further includes determining intermittently, using an ensemble learning process, based on the measurement data and the contextual information, one of a plurality of medical state prediction models best suited for a current clinical situation associated with the patient. The method additionally includes determining, by the determined medical state prediction model, based on the measurement data and the clinician behavior data, prediction output data representing a medical and/or clinical state trajectory for the patient, and providing notification output data representative of the medical and/or clinical state trajectory for the patient.

IPC Classes  ?

• G16H 50/30 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indicesICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for individual health risk assessment
• G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
• G16H 50/70 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for mining of medical data, e.g. analysing previous cases of other patients

Abstract

Provided herein are methods of regulating a subject's preference for fat and/or sugar and methods of screening a substance for an ability to activate a nutrient receptor in a subject's gut.

IPC Classes  ?

• A61K 31/5513 - 1,4-Benzodiazepines, e.g. diazepam
• A61K 31/47 - QuinolinesIsoquinolines
• A61K 31/662 - Phosphorus acids or esters thereof having P—C bonds, e.g. foscarnet, trichlorfon
• A61K 38/22 - Hormones
• A61P 3/02 - Nutrients, e.g. vitamins, minerals

Abstract

Compounds for, and methods of, modeling and treating a neurodegenerative disease, including without limitation frontal temporal dementia (FTD), are provided. An effective dose of a pharmaceutical composition is administered to a patient in need thereof, where the pharmaceutical composition targets at least one muscleblind-like protein (MBNL) binding site on exon 10 of microtubule-associated protein tau (MAPT) to block MBNL binding thereto. The at least one MBNL binding site may be 2 binding sites. The pharmaceutical composition may include the nuclease-inactive dCas13d in complex, with one or more guide RNAs, and/or antisense oligonucleotides (ASOs).

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof

Abstract

Disrupting convergence of lytic granules produced by cytotoxic lymphocytes allows non-directional degranulation, which improves and broadens killing efficiency of the cytotoxic cells in pathogenic environments such as when used for cancer therapy. Accordingly, methods of inducing multidirectional degranulation by cytotoxic effector cells in a tumor microenvironment, methods of treating a tumor, and related therapeutic composition are described.

IPC Classes  ?

• A61K 39/00 - Medicinal preparations containing antigens or antibodies
• C12N 5/0783 - T cellsNK cellsProgenitors of T or NK cells
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

Disclosed are systems, methods, computer program products, and other implementations, including a method for signal detection is disclosed that includes obtaining samples of observation data comprising a signal component produced by a source object, and a noise component, and generating based on at least one of the samples of the observation data, processed by a machine learning template derivation system, a filtering template to separate the signal component from the noise component, with the machine learning template derivation system including one or more trainable layers, and with at least one layer of the one or more trainable layers implementing a respective one of one or more iterations of an unrolled optimization process to determine optimized template parameters for the filtering template. The method further includes applying the filtering template to one or more of the samples of the observation data to obtain the signal component of the observation data.

IPC Classes  ?

• G06N 3/084 - Backpropagation, e.g. using gradient descent

Abstract

The subject matter discloses a metasurface hologram system, including at least a vacuum chamber, where an atomic array is configured to be trapped with various geometries, at least a laser generator, configured to generate one or more incident laser beams, and at least a metasurface hologram, configured to generate trap arrays.

IPC Classes  ?

• G02B 1/00 - Optical elements characterised by the material of which they are madeOptical coatings for optical elements
• G21K 1/00 - Arrangements for handling particles or ionising radiation, e.g. focusing or moderating

Abstract

A 3D printed structure is provided. The structure includes a composition formed from a mixture including an earth component, e.g., naturally occurring soil, subsoil, topsoil, clay, a clay-rich soil, sand, silt, an engineered soil formed of sand and clay, etc.; at least one fiber component, e.g., a bast or leaf fiber, including straw, wheat straw, rice straw, rice husk, reed, hay, hemp, kenaf, banana, sisal, fique, flax, jute, etc.; fluid component, e.g., water, oil, acid, etc.; and at least one additive component, e.g., a bio-based additive such as cellulose, a polypeptide such as gelatin, a polysaccharide such as alginate, guar gum, locust bean gum, chitosan, and xanthan gum, and lime, etc. The mixture includes a weight ratio of about 2-50 parts earth; about 5-50 parts fiber; about 25-80 parts fluid; and about 0-10 parts additive. The mixture can be 3D printed into prefabricated building elements, e.g., block-like geometries, monolithic walls, panels, etc.

IPC Classes  ?

• E04C 2/04 - Building elements of relatively thin form for the construction of parts of buildings, e.g. sheet materials, slabs, or panels characterised by specified materials of concrete or other stone-like materialBuilding elements of relatively thin form for the construction of parts of buildings, e.g. sheet materials, slabs, or panels characterised by specified materials of asbestos cement
• B28B 1/00 - Producing shaped articles from the material
• B33Y 10/00 - Processes of additive manufacturing
• B33Y 70/10 - Composites of different types of material, e.g. mixtures of ceramics and polymers or mixtures of metals and biomaterials
• B33Y 80/00 - Products made by additive manufacturing

Abstract

A method of modifying a nucleotide in a kinase gene on a double-stranded DNA molecule in a mammalian cell, the method comprising introducing to the cell a composition comprising a guide RNA molecule comprising a spacer sequence portion and a fusion protein comprising a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) nuclease and a base editing enzyme.

IPC Classes  ?

• C12N 15/90 - Stable introduction of foreign DNA into chromosome
• C12N 9/22 - Ribonucleases
• C12N 9/78 - Hydrolases (3.) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12Q 1/6876 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Abstract

Mechanisms, including systems, methods, and media for establishing authenticity of image content are provided, the methods including: capturing an image using a camera; digitally signing the image using the camera to create a digital signature; and storing a first copy of the image in remote storage with the digital signature. In some embodiments, the image and the digital signature are stored in a blockchain. In some embodiments, the methods further comprise: retrieving a second copy of the image; and determining whether the second copy of the image is authentic based on the digital signature. In some embodiments, the methods further comprise generating an indicator that indicates to a person whether the second copy of the image is authentic. In some embodiments, the methods further comprise storing an indicator of edits made in the edited copy in the blockchain.

IPC Classes  ?

• H04L 9/32 - Arrangements for secret or secure communicationsNetwork security protocols including means for verifying the identity or authority of a user of the system
• H04L 9/00 - Arrangements for secret or secure communicationsNetwork security protocols

Abstract

Transmembrane proteases are necessary for HPIV3 fusion protein cleavage in the human lung. HPIV3 fusion protein cleavage in the human lung is not furin dependent as previously thought, but instead is facilitated by transmembrane proteases, typically targeting TMPRSS2 expression. Serine protease inhibitors may be used in this manner to treat HPIV in a patient. Particular serine protease inhibitors shown to be effective include nafamostat, camostat, aprotinin, and leupeptin. Method of treating HPIV use serine protease inhibitors as treating agents.

IPC Classes  ?

• A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
• A61K 31/132 - Amines, e.g. amantadine having two or more amino groups, e.g. spermidine, putrescine
• A61K 31/245 - Amino benzoic acid types, e.g. procaine, novocaine
• A61P 31/16 - Antivirals for RNA viruses for influenza or rhinoviruses

Abstract

The present disclosure provides methods of treating and preventing trigeminal nerve pain with modulators of oxidative stress (e.g., NRF2 transcription network activators and/or inhibitors of transient receptor potential ankyrin 1 (TRPA1)) and compositions thereof.

IPC Classes  ?

• A61K 33/24 - Heavy metalsCompounds thereof
• A61K 31/26 - Cyanate or isocyanate estersThiocyanate or isothiocyanate esters
• A61K 31/522 - Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
• A61K 31/551 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogens as ring hetero atoms, e.g. clozapine, dilazep
• A61K 31/5685 - Compounds containing cyclopenta[a]hydrophenanthrene ring systemsDerivatives thereof, e.g. steroids not substituted in position 17 beta by a carbon atom, e.g. oestrane, oestradiol substituted in positions 10 and 13 by a chain having at least one carbon atom, e.g. androstane, testosterone having an oxo group in position 17, e.g. androsterone
• A61P 25/04 - Centrally acting analgesics, e.g. opioids

Abstract

This disclosure is related to a method of sequencing a single-stranded DNA using deoxynucleotide polyphosphate analogues and translocation of tags from incorporated deoxynucleotide polyphosphate analogues through a nanopore.

IPC Classes  ?

• C12Q 1/6869 - Methods for sequencing
• C07H 19/10 - Pyrimidine radicals with the saccharide radical being esterified by phosphoric or polyphosphoric acids
• C07H 21/00 - Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
• G01N 33/487 - Physical analysis of biological material of liquid biological material

Abstract

Media for making esophageal organoids, methods of making an esophageal organoid using that media, and esophageal organoids produced by those methods

IPC Classes  ?

• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
• C12N 5/09 - Tumour cells

Abstract

The subject matter described herein relates to a method of treating cancer in a subject in need thereof using a bispecific molecule recognizing two antigen markers of different tissue lineages on the surface of The First Cell.

IPC Classes  ?

• C07K 16/30 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
• A61K 47/68 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• G01N 33/574 - ImmunoassayBiospecific binding assayMaterials therefor for cancer

Abstract

Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF (the “FHF-inhibiting-X-region” (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5′-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3′ (SEQ ID NO: 1). As pathophysiological impact of late Na current extends beyond cardiac myocytes to other physiological settings, including neurons of the central and peripheral nervous system and skeletal muscle, these treatments and methods provide potential therapeutic avenues for a range of human ailments, including cardiac conditions, neurological/neuropsychiatric disorders, and skeletal muscle conditions. Neurological/neuropsychiatric disorders include, for example, epilepsy and autism spectrum disorders, pain-related diseases, and myotonia.

IPC Classes  ?

• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61K 38/18 - Growth factorsGrowth regulators
• A61P 9/06 - Antiarrhythmics
• C12N 15/86 - Viral vectors

Abstract

The method of treating obesity and targeting adipose tissue in a patient may use injection of a polycationic polymer, such as polyamidoamine (PAMAM) generation 3 (P-G3) or a PCL-g-PAMAM Denpol, that when delivered intraperitoneally, selectively targets visceral adiposity due to its high charge density. P-G3 treatment of obese mice inhibits visceral adiposity, increases energy expenditure, prevents obesity, and alleviates associated metabolic dysfunctions. The extracellular matrix of adipose tissue is enriched with glycosaminoglycans, the known biomacromolecules with the strongest negative charge. P-G3 uncouples adipocyte lipid synthesis and storage from adipocyte development, creating adipocytes with normal functions but that are deficient in hypertrophic growth. The visceral fat distribution of P-G3 is further enhanced by modifying P-G3 with cholesterol to form lipophilic nanoparticles, effective in treating obesity. This strategy provides a method to target visceral adiposity, and cationic nanomaterials useful for treating metabolic diseases or for delivery of additional treating agents.

IPC Classes  ?

• A61K 31/785 - Polymers containing nitrogen
• A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• A61K 47/28 - Steroids, e.g. cholesterol, bile acids or glycyrrhetinic acid
• A61P 3/04 - AnorexiantsAntiobesity agents

Abstract

Examples of syringe assemblies and sets of components are disclosed for transferring a fluid sample for testing. In some examples, the syringe assembly comprises a housing, a barrel, a plunger reciprocally moveable in the barrel, a narrow tube connected to the barrel, and a metering actuator configured to control movement of the plunger at least in a proximal direction relative to the barrel. The metering actuator is configured to draw a precise microvolume of the fluid sample into a fluid chamber within the syringe assembly. In some examples, while the fluid chamber holds the fluid sample, the distal tip of the narrow tube remains covered, for example inside the housing or a reaction container. The syringe assembly is configured to expel the fluid sample from the fluid chamber into the reaction container.

IPC Classes  ?

• B01L 3/02 - BurettesPipettes

Abstract

Processes, compositions, and apparatus are disclosed. A first process includes providing a cyclopropenimine (CPI). A second process includes providing 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU). The first and second processes include reacting the CPI and DBU, respectively, with carbon dioxide (CO2) in the presence of a nucleophilic species (NuH) and releasing CO2 from products of the reactions by heating to a temperature below about 120° C. A process of direct air capture includes obtaining atmospheric CO2, reacting the CO2 with an organic base having an imine moiety to form a NuCO2− salt, and heating the NuCO2− salt to a temperature below about 120° C. A composition for low-temperature CO2 release includes a tris(amino)cyclopropenium (TAC+) ion and NuCO2−. An apparatus includes a component configured to provide a composition, including a CPI, for capturing CO2 and a component configured to release the CO2 by heating a to a temperature below 120° C.

IPC Classes  ?

• B01J 20/26 - Synthetic macromolecular compounds
• B01D 53/04 - Separation of gases or vapoursRecovering vapours of volatile solvents from gasesChemical or biological purification of waste gases, e.g. engine exhaust gases, smoke, fumes, flue gases or aerosols by adsorption, e.g. preparative gas chromatography with stationary adsorbents
• B01J 20/28 - Solid sorbent compositions or filter aid compositionsSorbents for chromatographyProcesses for preparing, regenerating or reactivating thereof characterised by their form or physical properties
• B01J 20/32 - Impregnating or coating

Abstract

Disclosed are methods of epigenetic mapping with low input capabilities that enable applications to human tissues. The method can also be incorporated with automated/semi-automated capabilities to enable the use epigenetic mapping in prospective clinical trials. The methods comprise shearing the isolated chromatin using focused ultrasonication technology, preferably at least twice, prior to immunoprecipitation of the sheared chromatin and isolation for subsequent DNA analysis.

IPC Classes  ?

• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Abstract

Compositions and methods for treating or preventing nonalcoholic steatohepatitis (NASH) fibrosis, also known as MASH. In one aspect, the disclosed methods relate to targeting a MBOAT7 risk variant, rs641738, in order to increase MBOAT7 expression and down-stream signaling or to silence TAZ. The compositions and methods disclosed herein can be used as disease modifying therapies to enable treatment of NASH fibrosis/MASH and related disorders earlier in disease progression and improve clinical outcomes.

IPC Classes  ?

• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61K 38/45 - Transferases (2)
• C12N 15/86 - Viral vectors

Abstract

Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Also disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using polynucleotides, polypeptides and/or agents which increase efficiency of the “fork reversion and repair” pathway and/or decrease detrimental outcomes such as fork collapse, translesion synthesis and/or gap formation. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Also disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using polynucleotides, polypeptides and/or agents which increase efficiency of the “fork reversion and repair” pathway and/or decrease detrimental outcomes such as fork collapse, translesion synthesis and/or gap formation. Lastly disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using one or more polynucleotides or polypeptides including but not limited to CHEK1, WEE1, ETAA1, ATRX, BLM, BRCA2, CHD4, DNA2 (DNA2L), EXO1, FANCC, FANCG, FBH1 (FBX018), HLTF (SMARCA3), MCM9, MSH6, POLD3, POLK, RAD51, RAD52, RAD54L, RB1, RECQL, REV3L, RIF1, RNF8, SETD1A, SHPRH, SMARCAL1, TDRD3, TOPBP1, TP53BP1, WRNIP1, XRCC2, WRN, BRCAI, ZRANB3, CDC6, CDT1, POLH, POLI, FANCD2, INO80, FANCB, ASH2L, FAM35A, XRCC3, BRIP1, and RNF168.

IPC Classes  ?

• C12N 5/073 - Embryonic cells or tissuesFoetal cells or tissues
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

Provided are devices that have a distal portion configured to be implanted in a brain of a subject. The distal portion includes one or more emitters configured to emit light in the visible spectrum. The device includes a proximal portion configured to be external to the brain of the subject while the distal portion is implanted, wherein the proximal portion includes at least one waveguide in optical communication with the one or more emitters. The at least one waveguide defines a cross-sectional width less than 500 nm. The at least one waveguide is optionally coupled to a heating element that is optionally configured to adjust a phase of light within the at least one waveguide.

IPC Classes  ?

• G02F 1/01 - Devices or arrangements for the control of the intensity, colour, phase, polarisation or direction of light arriving from an independent light source, e.g. switching, gating or modulatingNon-linear optics for the control of the intensity, phase, polarisation or colour
• A61N 5/06 - Radiation therapy using light

Abstract

The present inhibitory polypeptides/peptides are derived from an envelope (E) protein of a coronavirus (e.g., human coronaviruses such as SARS-CoV-2). The polypeptides/peptides against coronaviruses can be used to treat or prevent infection by a coronavirus in a subject.

IPC Classes  ?

• C07K 14/005 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from viruses
• A61K 38/00 - Medicinal preparations containing peptides
• A61P 31/14 - Antivirals for RNA viruses

Abstract

Provided herein are methods of xenotransplantation, for example, porcine to human transplantation. Also provided herein are extracellular vesicles (“EVs”, e.g., exosomes) and compositions comprising the same. e.g. EVs expressing human CD47. Further provided herein are methods of making EVs and use thereof for xenotransplantation. In some aspects, the methods of xenotransplantation comprise steps of expressing human CD47 on xenografts.

IPC Classes  ?

• A61K 35/12 - Materials from mammalsCompositions comprising non-specified tissues or cellsCompositions comprising non-embryonic stem cellsGenetically modified cells
• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues

Abstract

The present disclosure provides, inter alia, methods for treating neurodegenerative disease including Alzheimer's disease. Methods for restoring retromer complex function in a subject, methods for determining the progression of a neurodegenerative disease in a subject, and in vivo methods for identifying a DNA-binding profile of a dimeric transcription factor complex such as the retromer complex are also provided. Further provided are methods for restoring amyloid precursor protein (APP) homeostasis in a subject in need thereof, methods for restoring tau metabolism in a subject in need thereof, compositions and methods for preventing CREB3L2-ATF4 heterodimerization in a subject using such compositions, and methods for rescuing AP42-induced neuronal cell death in a subject using such compositions.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12Q 1/6874 - Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation [SBH]
• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
• G01N 33/68 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing involving proteins, peptides or amino acids

Abstract

Described herein is a method for diagnosing cancer in a subject, the method comprising determining methylation status at a plurality of CpG sites within a region of a RAD9 gene in DNA present in a urine sample from the subject, wherein an amount of methylation of the plurality of CpG sites that exceeds a threshold indicates that the subject has cancer. Also described are methods of treatment, methods of assessing a methylation status of DNA present in a urine sample obtained from a human subject, methods of detecting methylation or unmethylation of a RAD9 DNA molecule of a human subject, kits, nucleic acid primers, and compositions.

IPC Classes  ?

• C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

Abstract

The invention relates to methods and pharmaceutical compositions effective for treating, inhibiting, preventing, slowing, or delaying the onset of a neurodegenerative disease in mammals (e.g., humans) via the co-administration of an effective amount of a compound selected from the group consisting of Formula (I), Formula (II), Formula (III) or Formula (IV) or pharmaceutically acceptable salts thereof and a phosphodiesterase inhibitor (e.g., a PDE 5 inhibitor). In certain embodiments, the mammal is a healthy human, or a human experiencing cognitive dysfunction with or without hypertension.

IPC Classes  ?

• A61K 31/407 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with heterocyclic ring systems, e.g. ketorolac, physostigmine
• A61K 31/47 - QuinolinesIsoquinolines
• A61K 31/4985 - Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems
• A61K 31/506 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 31/53 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with three nitrogens as the only ring hetero atoms, e.g. chlorazanil, melamine
• A61P 25/16 - Anti-Parkinson drugs
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

Multiple fluorophores within a sample can be imaged by merging a plurality of beams from different wavelength light sources of excitation light into a single path, directing the excitation light into the sample, and detecting light emitted by the fluorophores within the sample on two different arrays of pixels (e.g., two regions within a single camera sensor chip). The light sources are activated during respective timeslots, and captured image data is processed. For at least one of the timeslots, the processing of the image data comprises using the image data captured using the first array of pixels to detect a presence of a given fluorophore, and using the image data captured using the second array of pixels to detect a presence of a different fluorophore. This arrangement enables a system that includes only N light sources to image more than N fluorophores.

IPC Classes  ?

• G01N 21/64 - FluorescencePhosphorescence

Abstract

The hybrid nanoporous membranes are assembled from inorganic 3D nanospiky particles and polymers, and can be used to filter, capture, and manipulate environmental or biological substances. These materials provide efficient, continuous filtration of ultrasmall biological substances with sizes less than 100 nm while still maintaining air or fluid flow through the materials.

IPC Classes  ?

• B01D 39/20 - Other self-supporting filtering material of inorganic material, e.g. asbestos paper or metallic filtering material of non-woven wires
• A41D 13/11 - Protective face masks, e.g. for surgical use, or for use in foul atmospheres
• B01D 39/16 - Other self-supporting filtering material of organic material, e.g. synthetic fibres

Abstract

An exemplary system, method, and computer-accessible medium for generating diagnostic data associated with a likelihood a patient(s) developing a mental disease(s) can be provided, which can include, for example, providing a visual patterns to the patient(s), receiving electroencephalogram (EEG) information from the patient(s) that can be based on the visual pattern(s); and generating the diagnostic data based on the EEG information.

IPC Classes  ?

• A61B 5/378 - Visual stimuli
• A61B 5/00 - Measuring for diagnostic purposes Identification of persons
• A61B 5/374 - Detecting the frequency distribution of signals, e.g. detecting delta, theta, alpha, beta or gamma waves

Abstract

A method for injecting a therapeutic into the inner ear of a subject comprising providing a microneedle having a sharpened distal tip and a shaft with a maximum outer diameter of about 75 microns to about 150 microns, the microneedle defining an inner lumen with a diameter about 15 microns to about 50 microns; the inner lumen having a curvature near the needle tip such that the lumen opened at the side of the needle proximal the needle tip; the microneedle mounted on a blunt metallic syringe needle; the blunt metallic syringe needle attached to a syringe secured to a micropump; advancing the microneedle into the middle ear space and the perforating the round window membrane (RWM) with the needle tip; extending the needle such that the inner lumen is disposed in the inner ear space; injecting a volume of therapeutic into the inner ear space; and retracting of the microneedle from the RWM.

IPC Classes  ?

• A61M 37/00 - Other apparatus for introducing media into the bodyPercutany, i.e. introducing medicines into the body by diffusion through the skin

Abstract

In one aspect the present invention is directed to mutant NGAL proteins that have the ability to bind to siderophores, such as enterochelin, and to chelate and transport iron, and that are excreted in the urine. Such NGAL mutants, and complexes thereof with siderophores, can be used to clear excess iron from the body, for example in the treatment of iron overload. The NGAL mutants of the invention also have antibacterial activity and can be used in the treatment of bacterial infections, such as those of the urinary tract.

IPC Classes  ?

• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
• A61K 38/00 - Medicinal preparations containing peptides

Abstract

The present invention relates to methods for regulating prohormone convertase (PC1) and compounds and treatments which increase PC1 levels, for treating Prader-Willi Syndrome (PWS).

IPC Classes  ?

• A61K 31/366 - Lactones having six-membered rings, e.g. delta-lactones
• A61K 31/277 - NitrilesIsonitriles having a ring, e.g. verapamil
• A61K 31/352 - Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. cannabinols, methantheline
• A61K 31/4015 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil having oxo groups directly attached to the heterocyclic ring, e.g. piracetam, ethosuximide
• A61K 31/403 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
• A61K 31/4035 - Isoindoles, e.g. phthalimide
• A61K 31/4162 - 1,2-Diazoles condensed with heterocyclic ring systems
• A61K 31/426 - 1,3-Thiazoles
• A61K 31/437 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
• A61K 31/4375 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having nitrogen as a ring hetero atom, e.g. quinolizines, naphthyridines, berberine, vincamine
• A61K 31/44 - Non-condensed pyridinesHydrogenated derivatives thereof
• A61K 31/454 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
• A61K 31/517 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 31/522 - Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
• A61K 31/5513 - 1,4-Benzodiazepines, e.g. diazepam
• A61K 31/69 - Boron compounds
• A61K 38/00 - Medicinal preparations containing peptides
• A61K 38/08 - Peptides having 5 to 11 amino acids
• A61K 38/095 - OxytocinsVasopressinsRelated peptides
• A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• A61P 43/00 - Drugs for specific purposes, not provided for in groups

Abstract

Mechanisms for verifying software are provided, the mechanisms including: identifying a plurality of layers of code of the software including a lowest layer, a middle layer, and a highest layer; generating a low-level specification and an identical refinement proof for each of the plurality of layers using a hardware processor; generating a high-level specification and a lifting refinement proof for each of the plurality of layers; and verifying the software based on the low-level specifications, the identical refinement proofs, the high-level specifications, and the lifting refinement proofs. In some embodiments, one of the low-level specifications is generated using Fixedpoint construction. In some embodiments, one of the high-level specifications is generated by applying a set of transformation rules to one of the low-level specifications.

IPC Classes  ?

• G06F 21/57 - Certifying or maintaining trusted computer platforms, e.g. secure boots or power-downs, version controls, system software checks, secure updates or assessing vulnerabilities

Abstract

An animal positioned on a perforated platform can be stimulated in an automated fashion. Images of the animal's paw are captured using a bottom-view camera positioned below the platform. Based on these images, an upwards-pointing tool is moved until it is directly beneath the paw. The animal is then stimulated automatically by moving the tool upwards to contact the paw, then moving it back down to cease the contact. Images of the animal are captured using at least one side-view camera, and these images can be analyzed to ascertain the animal's response to the stimulus.

IPC Classes  ?

• A61D 7/00 - Devices or methods for introducing solid, liquid, or gaseous remedies or other materials into or onto the bodies of animals
• G03B 17/56 - Accessories
• H04N 23/695 - Control of camera direction for changing a field of view, e.g. pan, tilt or based on tracking of objects
• H04N 23/74 - Circuitry for compensating brightness variation in the scene by influencing the scene brightness using illuminating means

Abstract

The present disclosure provides systems and methods for isolation of nucleic acids. In particular, provided herein are nanopore-based or substrate-based sequencing systems and methods of use thereof for isolation of desired nucleic acids from a mixed library containing both accurate and inaccurate strands.

IPC Classes  ?

• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12Q 1/6869 - Methods for sequencing
• G16B 30/00 - ICT specially adapted for sequence analysis involving nucleotides or amino acids

Abstract

The present disclosure provides, inter alia, a recombinant engineered deubiquitinase (DUB) and methods for treating or ameliorating an inherited ion channelopathy, such as long QT syndrome, Brugada syndrome, or cystic fibrosis, in a subject. Further provided are methods for screening mutations causing such inherited ion channelopathies for a trafficking-deficient mutation that is treatable by the recombinant engineered DUB disclosed herein.

IPC Classes  ?

• C12N 9/64 - Proteinases derived from animal tissue, e.g. rennin
• A61K 38/00 - Medicinal preparations containing peptides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

Abstract

The present disclosure provides, inter alia, a recombinant engineered deubiquitinase (DUB) and methods for treating or ameliorating an inherited ion channelopathy, such as long QT syndrome, Brugada syndrome, or cystic fibrosis, in a subject. Further provided are methods for screening mutations causing such inherited ion channelopathies for a trafficking-deficient mutation that is treatable by the recombinant engineered DUB disclosed herein.

IPC Classes  ?

• C12N 9/64 - Proteinases derived from animal tissue, e.g. rennin
• A61K 38/00 - Medicinal preparations containing peptides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

Abstract

Methods to prevent, inhibit or treat a neurodegenerative disease, e.g., one having protein aggregates, as well as compositions useful in that regard, are provided.

IPC Classes  ?

• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61K 9/127 - Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
• A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

The disclosed subject matter provides systems and methods for predicting a spontaneous preterm birth based on transvaginal ultrasound images of a subject. An example method can include providing a preterm birth prediction model, obtaining one or more transvaginal ultrasound images of the subject, each including cervical features, determining measurements of a plurality of cervical structure features from the one or more ultrasound images, assessing, using the preterm birth prediction model, cervical health of the subject based on the measurements of the plurality of cervical structure features, and calculating the spontaneous preterm birth risk based on the assessed cervical health, using the preterm birth prediction model.

IPC Classes  ?

• A61B 8/12 - Diagnosis using ultrasonic, sonic or infrasonic waves in body cavities or body tracts, e.g. by using catheters
• A61B 5/00 - Measuring for diagnostic purposes Identification of persons

Abstract

The invention discloses PU7-1, pharmaceutical compositions comprising PU7-1, and methods of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of PU7-1.

IPC Classes  ?

• A61K 31/517 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
• A61P 35/00 - Antineoplastic agents
• C07D 401/14 - Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings

Abstract

Disclosed herein are methods of treating and/or prophylaxis of a disease or condition associated with cellular stress granule formation in a mammal via administration of small molecule compounds. Also disclosed herein are chemical compounds effective in treating diseases or conditions associated with aberrant cellular stress responses and/or stress granule formation.

IPC Classes  ?

• A61K 31/41 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which is nitrogen, e.g. tetrazole
• A61K 31/44 - Non-condensed pyridinesHydrogenated derivatives thereof
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 31/69 - Boron compounds
• G01N 33/68 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing involving proteins, peptides or amino acids

Abstract

CAR Tregs and Tregs are provided which are both conversion-resistant and condition-resistant. The Treg cells are engineered such that they are deficient in or substantially devoid of a cell-surface marker or antigen.

IPC Classes  ?

• A61K 39/00 - Medicinal preparations containing antigens or antibodies
• A61P 37/06 - Immunosuppressants, e.g. drugs for graft rejection
• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• C12N 5/0783 - T cellsNK cellsProgenitors of T or NK cells
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

The disclosed subject matter relates to a photonically integrated atomic tweezer clock. An example atomic tweezer clock can include a laser system, a holographic metasurface, a vacuum system, and a cold atoms source, wherein the holographic metasurface generates an optical tweezer array, and the atoms are trapped by the optical tweezer array in the vacuum system for generating an atomic tweezer clock. In certain embodiments, the laser system is integrated with frequency combs in chip-scale to ensure compactness and robustness.

IPC Classes  ?

• G21K 1/00 - Arrangements for handling particles or ionising radiation, e.g. focusing or moderating
• G04F 5/14 - Apparatus for producing preselected time intervals for use as timing standards using atomic clocks

Abstract

An ultrasound phased array integrated in flexible CMOS technology is provided. The CMOS IC chip is fabricated through various chip-thinning techniques, resulting in mechanical flexibility, robustness, and minimized mechanical loading for the piezoelectric transducers. The ultrasound phased array CMOS patch can allow for the generation of high intensity focal regions for maximum penetration in regions of interest.

IPC Classes  ?

• A61B 8/00 - Diagnosis using ultrasonic, sonic or infrasonic waves
• A61N 7/00 - Ultrasound therapy

Abstract

The present disclosure provides organic compounds having pseudocapacitive performance and methods of preparing said compounds. The organic compounds can include perylene diamine (PDI) subunits and hexaazatrinaphthylene (HATN) subunits.

IPC Classes  ?

• C08G 61/12 - Macromolecular compounds containing atoms other than carbon in the main chain of the macromolecule
• H01G 11/48 - Conductive polymers

Abstract

Introduce into a reactor a polyurethane having a benzylic linkage. In one aspect, induce a chemical reduction through a reducing agent and a catalyst to depolymerize the polyurethane having the benzylic linkage. In another aspect, introduce hydrogen bromide into the reactor, and react the polyurethane with the hydrogen bromide to recover constituents of the polyurethane via acid-catalyzed bromine-substitution to cleave the benzylic linkage of the polyurethane.

IPC Classes  ?

• C08J 11/16 - Recovery or working-up of waste materials of polymers by chemically breaking down the molecular chains of polymers or breaking of crosslinks, e.g. devulcanisation by treatment with inorganic material

Abstract

Provided herein are heterocyclic derivative compounds and pharmaceutical compositions comprising said compounds that are useful for the treatment of retinal binding protein (RBP4) related diseases, such as obesity and the like.

IPC Classes  ?

• A61K 31/4545 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
• A61K 9/00 - Medicinal preparations characterised by special physical form
• A61K 31/4985 - Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 31/5365 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and at least one oxygen as the ring hetero atoms, e.g. 1,2-oxazines ortho- or peri-condensed with heterocyclic ring systems
• A61K 31/5383 - 1,4-Oxazines, e.g. morpholine ortho- or peri-condensed with heterocyclic ring systems
• A61P 3/04 - AnorexiantsAntiobesity agents
• A61P 3/10 - Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics

Abstract

A plurality of modules are simultaneously positioned at locations that correspond to different angiosomes. Each of these modules has a front surface shaped and dimensioned for contacting a person's skin, a plurality of different-wavelength light sources aimed in a forward direction, and a plurality of light detectors aimed to detect light arriving from in front of the front surface. Each module is supported by a support structure (e.g., a strap or a clip) that is shaped and dimensioned to hold the front surface adjacent to the person's skin at a respective position. Perfusion in each of the angiosomes is monitored using these modules, and the surgeon can rely on this information to guide his or her intervention.

IPC Classes  ?

• A61B 5/026 - Measuring blood flow
• A61B 5/00 - Measuring for diagnostic purposes Identification of persons
• A61B 5/02 - Detecting, measuring or recording for evaluating the cardiovascular system, e.g. pulse, heart rate, blood pressure or blood flow
• A61B 5/021 - Measuring pressure in heart or blood vessels
• A61B 5/022 - Measuring pressure in heart or blood vessels by applying pressure to close blood vessels, e.g. against the skinOphthaldynamometers
• A61B 5/0225 - Measuring pressure in heart or blood vessels by applying pressure to close blood vessels, e.g. against the skinOphthaldynamometers the pressure being controlled by electric signals, e.g. derived from Korotkoff sounds
• A61B 5/0245 - Measuring pulse rate or heart rate using sensing means generating electric signals
• A61B 5/1455 - Measuring characteristics of blood in vivo, e.g. gas concentration or pH-value using optical sensors, e.g. spectral photometrical oximeters

Abstract

Disclosed herein is a biochip with a plurality of endothelial cells (e.g., Schlemm's canal cells) having a plurality of pores (e.g., transcellular pores) and methods of making and using the same.

IPC Classes  ?

• B01L 3/00 - Containers or dishes for laboratory use, e.g. laboratory glasswareDroppers
• C12N 5/00 - Undifferentiated human, animal or plant cells, e.g. cell linesTissuesCultivation or maintenance thereofCulture media therefor
• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues

Abstract

Systems, methods, and devices for generating tunable low frequency signals, such as microwave and radiofrequency signals are disclosed. A first waveguide in optical communication with a first ring resonator can be configured to receive a light input and generate frequencies via optical parametric oscillation. A second waveguide with second ring resonator can receive the frequencies and optically synchronize the frequencies via optical frequency division to generate a low frequency signal. One or more heating elements can be connected to each ring resonator to tune the resonators and reduce noise associated with the low frequency signal.

IPC Classes  ?

• G02F 1/39 - Non-linear optics for parametric generation or amplification of light, infrared, or ultraviolet waves
• G02F 1/01 - Devices or arrangements for the control of the intensity, colour, phase, polarisation or direction of light arriving from an independent light source, e.g. switching, gating or modulatingNon-linear optics for the control of the intensity, phase, polarisation or colour

Abstract

A system may mitigate leakage currents in charging stations for electric vehicles. The system may include a bank of one or more parallel capacitors per phase electrically coupled to an AC voltage source, wherein a neutral point of the one or more parallel capacitors is electrically coupled to a DC ground; a bank of one or more inductors per phase electrically coupled to the one or more parallel capacitors, wherein each inductor is in series with and downstream from one capacitor; a rectifier electrically coupled to and downstream from the one or more parallel inductors, wherein the rectifier converts the AC voltage source to a DC voltage for supply to a battery; a DC bus electrically coupled to the rectifier; and a controller, wherein the controller is configured to mitigate leakage currents by controlling a voltage of at least one of the bank of one or more parallel capacitors.

IPC Classes  ?

• H02J 7/00 - Circuit arrangements for charging or depolarising batteries or for supplying loads from batteries
• B60L 53/30 - Constructional details of charging stations
• H02J 7/06 - Regulation of the charging current or voltage using discharge tubes or semiconductor devices
• H02M 1/44 - Circuits or arrangements for compensating for electromagnetic interference in converters or inverters
• H02M 3/158 - Conversion of DC power input into DC power output without intermediate conversion into AC by static converters using discharge tubes with control electrode or semiconductor devices with control electrode using devices of a triode or transistor type requiring continuous application of a control signal using semiconductor devices only with automatic control of output voltage or current, e.g. switching regulators including plural semiconductor devices as final control devices for a single load
• H02M 7/219 - Conversion of AC power input into DC power output without possibility of reversal by static converters using discharge tubes with control electrode or semiconductor devices with control electrode using devices of a triode or transistor type requiring continuous application of a control signal using semiconductor devices only in a bridge configuration

Abstract

Exemplary systems, methods, and computer-accessible medium are provided that can facilitate an electrogram feature set associated with an object. Thus, the exemplary systems, methods, and computer-accessible medium can be provided that can receive image information for the object and determine at least one characteristic of at least one portion of the object based on the image information and a time series voltage trace. The exemplary systems, methods, and computer-accessible medium are provided that can localize a reentry isthmus. Thus, exemplary systems, methods, and computer-accessible medium can be provided that can receive image information for an object and generate a probability map for the object based on a plurality of characteristics related to an electrogram feature set, and using the image information.

IPC Classes  ?

• G06T 7/00 - Image analysis
• A61B 18/00 - Surgical instruments, devices or methods for transferring non-mechanical forms of energy to or from the body
• A61B 18/14 - Probes or electrodes therefor

Abstract

The invention relates to a bioactive lipid (BAL) composition comprising one or more hydrocarbon-derivatized fatty acids (FAs), which can be an oxygenated, halogenated, amino, amide, nitro, cyano, furanoid, nitroso, isonitrile, or O-substituted derivative of the hydrocarbon-derivatized FA, which are bound to a molecular backbone. In some embodiments, the BALs comprise a specialized pro-resolving mediator (SPMs), eicosanoid, prostanoid, prostaglandin, or endocannabinoid (eCBs) and optionally further comprise omega-3 (n-3) FAs and/or omega-6 (n-6) FAs. In general, the BALs are conjugated to a molecular backbone, preferably a five- or six-carbon monosaccharide, or glycerol. The compositions can be formulated as an emulsion. Preferred BALs can be selected by their performance in one or more cellular assays or animal models. These compositions are useful for tissue or organ protection in a patient, for example in stroke, ischemia, traumatic injury, a neurodegenerative disorder, or organ injury and/or transplant.

IPC Classes  ?

• A61K 47/54 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
• A61K 47/59 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
• A61K 47/60 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

A minimally invasive device, containing a pressure channel, camera, and optical fiber imaging probe, to measure the stiffness of tissues in vivo and ex vivo is disclosed. The device is inserted into a patient and navigated to a tissue of interest, where stiffness is evaluated by applying suction and measuring the elongation or by applying compression force and measuring the compression of the tissue. Biopsies can be taken for further analysis, or tissue can be removed using an ablation laser. Small fluorescent molecules or therapeutics can also be delivered for improved visualization and targeted treatment. As such, this technology may be used to evaluate the stiffness of biomaterials as well as tissues and organs that are difficult to access, allowing for simultaneous diagnosis, treatment, and excision of diseased tissues.

IPC Classes  ?

• A61B 5/00 - Measuring for diagnostic purposes Identification of persons
• A61B 5/08 - Measuring devices for evaluating the respiratory organs
• A61B 18/24 - Surgical instruments, devices or methods for transferring non-mechanical forms of energy to or from the body by applying electromagnetic radiation, e.g. microwaves using laser the beam being directed along or through a flexible conduit, e.g. an optical fibreHand-pieces therefor with a catheter
• A61B 90/00 - Instruments, implements or accessories specially adapted for surgery or diagnosis and not covered by any of the groups , e.g. for luxation treatment or for protecting wound edges

Abstract

The present invention provides methods for using an anionic manganese oxide (MnO) nanoparticle-based nucleic acid scavenger to (1) inhibit viral infection of cells, (2) reduce or inhibit a viral infection of a subject, and (3) reduce viral infection induced inflammation in a subject.

IPC Classes  ?

• A61K 33/32 - ManganeseCompounds thereof
• A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
• A61P 37/06 - Immunosuppressants, e.g. drugs for graft rejection

Abstract

The invention provides for methods for treating a hair loss disorder in a subject by administering a Janus Kinase/Signal Transducers and Activators of Transcription inhibitor.

IPC Classes  ?

• A61Q 7/00 - Preparations for affecting hair growth
• A61K 8/41 - Amines
• A61K 8/49 - Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
• A61K 8/64 - ProteinsPeptidesDerivatives or degradation products thereof
• A61K 31/137 - Arylalkylamines, e.g. amphetamine, epinephrine, salbutamol, ephedrine
• A61K 31/277 - NitrilesIsonitriles having a ring, e.g. verapamil
• A61K 31/407 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with heterocyclic ring systems, e.g. ketorolac, physostigmine
• A61K 31/437 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
• A61K 31/506 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 31/52 - Purines, e.g. adenine
• A61K 31/529 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim forming part of bridged ring systems
• A61K 31/5377 - 1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
• A61K 31/553 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having at least one nitrogen and at least one oxygen as ring hetero atoms, e.g. loxapine, staurosporine
• A61K 31/63 - Compounds containing para-N-benzene- sulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonohydrazide
• A61K 31/7052 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
• A61K 31/713 - Double-stranded nucleic acids or oligonucleotides

Abstract

The present disclosure provides, inter alia, a recombinant engineered deubiquitinase (DUB) and methods for treating or ameliorating an inherited ion channelopathy, such as long QT syndrome, Brugada syndrome, or cystic fibrosis, in a subject. Further provided are methods for screening mutations causing such inherited ion channelopathies for a trafficking-deficient mutation that is treatable by the recombinant engineered DUB disclosed herein.

IPC Classes  ?

• C12N 9/64 - Proteinases derived from animal tissue, e.g. rennin
• A61K 38/00 - Medicinal preparations containing peptides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

Abstract

A method for practicing precision medicine comprising providing, to a blockchain platform, each of clinical data and genetic data, providing the blockchain platform, the blockchain platform having a first data structure comprising clinical data and a second data structure comprising genetic data, harmonizing the first and second data structures, creating at least one cohort based on the harmonized first and second data structures, and identifying at least one relationship between the clinical data and the genetic data in each of the at least one cohort.

IPC Classes  ?

• G16H 50/70 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for mining of medical data, e.g. analysing previous cases of other patients
• G06F 16/22 - IndexingData structures thereforStorage structures
• G06F 16/23 - Updating
• G06F 16/245 - Query processing